Chapter 17
High-Throughput SNP Genotyping: Combining Tag SNPs
and Molecular Beacons
Luis B. Barreiro, Ricardo Henriques, and Musa M. Mhlanga
Abstract
In the last decade, molecular beacons have emerged to become a widely used tool in the multiplex typing of
single nucleotide polymorphisms (SNPs). Improvements in detection technologies in instrumentation and
chemistries to label these probes have made it possible to use up to six spectrally distinguishable probes per
reaction well. With the remarkable advances made in the characterization of human genome diversity, it
has been possible to describe empirical patterns of SNPs and haplotype variation in the genome of diverse
human populations. These patterns have revealed that the human genome is structured in blocks of strong
linkage disequilibrium (LD). Because SNPs tend to be in LD with each other, common haplotypes share
common SNPs and thus the majority of the diversity in a region can be characterized by typing a very small
number of SNPs; so-called tag SNPs. Herein lies the advantage of the multiplexing ability of molecular
beacons, since it becomes possible to use as few as 30 probes to interrogate several haplotypes in a high-
throughput approach. Thus, through the combined use of tag SNPs and molecular beacons it becomes
possible to type individuals for clinically relevant haplotypes in a high-throughput manner at a cost that is
orders of magnitude less than that for high throughput sequencing methods.
Key words: Linkage disequilibrium, single nucleotide polymorphism, tagging single nucleotide
polymorphisms, DC-SIGN, Mycobacterium tuberculosis, molecular beacons, real-time PCR.
1. Introduction
Sanjay Tyagi the inventor of molecular beacons (1) once wrote:
Imagine that you have a magic reagent to which you add a
droplet of a body fluid from a patient; you wait for a moment
and a glow appears in the tube holding the mixture; the glow
not only tells you which pathogen is responsible for the
patient’s illness, but also indicates which drugs to use to
A.A. Komar (ed.), Single Nucleotide Polymorphisms, Methods in Molecular Biology 578,
DOI 10.1007/978-1-60327-411-1_17, ª Humana Press, a part of Springer Science+Business Media, LLC 2003, 2009
255

----!@#$NewPage!@#$----
treat the disease. Also imagine that you can perform this
diagnosis before any symptoms of the disease appear,
improving the chances of success with the treatment, and
you can perform this test on a large population with ease. The
creation and development of such reagents are the promise of
nucleic acid-based detection and are the aspiration of a
diverse community of researchers (2).
The promise of the technologies evoked by Sanjay Tyagi is
borne out in the above quotation. The sequencing of the human
genome (3) furnished an unprecedented understanding of its
structure and organization, but could not in itself account for
human biological variation. To address the latter, a number of
international consortiums or private corporations, such as the
International SNP Map Working Group, SeattleSNPs PGA, and
the Perlegen consortium, have multiplied efforts to resequence
genes or genomic regions to characterize single nucleotide poly-
morphism (SNP) variations in the human genome (4–6). To date,
more than 11 million SNPs have been recorded in dbSNP, the
public repository for DNA variation data (http://www.ncbi.nlm.
nih.gov/SNP/index.html) (see Chapter 3 for details). Decorating
the human genome at a frequency of one in every 500–1,000 bp,
they are the most common form of human variation and can serve
as high-resolution genetic markers. This variation, which repre-
sents a legacy of our evolutionary past and in the future may be a
treasure trove of information paving the way to personalized med-
icine, may at least partially explain the wide range of phenotypic
differences observed among individuals and populations (7–9).
These catalogues of sequence variation therefore provide scientists
and clinicians with the precious raw material to be exploited in
both human evolutionary studies and medically related research.
Here the major challenges have been in devising and implement-
ing cost-effective, easily accessible, and rapid molecular diagnostic
methods that can interrogate anywhere from a few dozen to
hundreds of thousands of polymorphisms. The comparison of
these SNPs among large numbers of individuals can be used in
therapy and drug design and even in devising new, more powerful
approaches in cell-based screening approaches for drug discovery.
It is these diverse and complicated needs that have driven the
creation of high-throughput methods of SNP typing.
Once genome sequence diversity has been catalogued, the
next step is to determine how this diversity is organized within
the human genome. Eleven million SNPs discovered to date
appear to be not entirely random. When a new mutation arises, it
is associated with neighboring variants present on the same chro-
mosome or haploid DNA molecule, forming what is commonly
known as a ‘‘haplotype.’’ When two alleles lying on the same
chromosome are always observed together, or at least more often
256
Barreiro, Henriques, and Mhlanga

----!@#$NewPage!@#$----
than expected by chance, these two variants are said to be in
linkage disequilibrium (LD). The HapMap project, a natural
extension of the Human Genome Project, was a pioneer in
describing empirically the patterns of SNP and haplotype variation
in the human genome and in obtaining a general LD map in
populations of different ethnic origins (10). HapMap data clearly
demonstrate that the human genome is organized in a LD block-
like structure and that these LD blocks are often disrupted by
recombination hotspots (11, 12). When SNPs are in LD with
each other, redundant information is contained within the haplo-
type (i.e., by knowing the marker at one locus, we can predict the
marker that will occur at the linked loci nearby). Thus, when one
infers haplotypes within a region of reasonable LD, the diversity of
haplotypes is accounted for by a few common haplotypes and lots
of rare ones. The common haplotypes will share a number of SNPs
in common with each other, whereas the rarer haplotypes will be
characterized by carrying the rarer alleles at certain loci. Thus, one
can capture the majority of the diversity within a region by typing
those SNPs which allow one to cover the most diversity; so-called
tag SNPs.
Currently, HapMap phase II provides the most complete
available resource for selecting tag SNPs genomewide (12).
Importantly, tag SNPs defined on the basis of the HapMap popu-
lations have been shown to adequately capture patterns of varia-
tion in other human groups; tag SNPs are therefore highly
‘‘portable’’ (13–15). In the practical sense, the HapMap data
have already proven to be useful, as attested by the increasing
number of successful genomewide association studies on diseases
as diverse as type 1 (16, 17) and type 2 (16, 18, 19) diabetes,
coronary artery disease (20), obesity-related traits (21, 22), rheu-
matoid arthritis (16, 23), and human immunodeficiency virus
(HIV) disease progression (24). The portability and utility of tag
SNPs opens up the possibility of their usage in ‘‘lower’’ high-
throughput methods that are cheaper to implement and broadly
accessible. Indeed, with a wide range of relatively cheap and robust
instruments (see Table 17.1) and multiplexing probes such as
molecular beacons, cost-effective high-throughput SNP typing
becomes a reality (see Fig. 17.1).
Two principal obstacles must be overcome in the detection
and analysis of SNPs. The first is the small amounts of nucleic acid
present in clinical specimens. This can be overcome by use of
differing nucleic acid amplification strategies, most notably poly-
merase chain reaction (PCR). This and other methods such as
nucleic acid sequence based amplification allow the selective
amplification and enrichment of a locus of interest by several-
thousand-fold over other nucleic acid sequences present (25).
The second obstacle is unambiguous detection of the SNP. Herein
lies an intrinsic property of nucleic acid chemistry that can be
High-Throughput SNP Genotyping
257

----!@#$NewPage!@#$----
Table 17.1
Specifications of spectrofluorometric thermal cyclers
Company
Model
Excitation
source
Fluorophore choicea
Multiplex
capability
Sample
capacity
Hybridization probe
compatibility
Applied Biosystems
7300 real-
time PCR
system
THL
FAM, TET, TMR, and Texas red
4 targets
96 wells
All types, less suited
for adjacent probes
Applied Biosystems
7500 real-
time PCR
system
THL
FAM, TET, TMR, Texas red, and Cy5
5 targets
96 wells
All types, less suited
for adjacent probes
Applied Biosystems
PRISM 7700
and
7900HT
ABLL
FAM, TET, HEX, TMR, ROX, and Texas red
6 targets
96 wells
and
384
wells
All types
Applied Biosystems
StepOne real-
time PCR
system
LED
FAM, HEX, and ROX
3 targets
48 wellsC
All types
Bio-Rad
MiniOpticon
LED
FAM and HEX
2 targets
48 wells
All types, less suited
for adjacent probes
Bio-Rad
Chromo 4
LED
FAM, TMR, Texas red, and Cy5
4 targets
96 wells
All types, less suited
for adjacent probes
Bio-Rad
ICycler IQ5
THL
FAM, HEX, TMR, Texas red, and Cy5
5 targets
96 wells
All types
Cepheid
SmartCycler
II
LED
FAM, Cy3, Texas red, and Cy5
4 targets
16 unitsb,c
All types, less suited
for adjacent probes
Corbett Research
Rotor-Gene
6000
LED
CPM, FAM, TET, Texas red, Cy5, and
LightCycler Red 705
6 targets
72 wellsc
All types
258
Barreiro, Henriques, and Mhlanga

----!@#$NewPage!@#$----
Eppendorf
Mastercycler
realplex 2
LED
FAM and HEX
2 targets
96 wells
All types, less suited
for adjacent probes
Eppendorf
Mastercycler
realplex 4
LED
FAM, TET, TMR, and Texas red
4 targets
96 wells
All types, less suited
for adjacent probes
Idaho
Technologies
R.A.P.I.D.
LED
FAM, LightCycler Red 640, and LightCycler
Red 705
3 targets
32 wellsc
All types
Roche Applied
Science
LightCycler
1.5
LED
FAM, LightCycler Red 640, and LightCycler
Red 705
3 targets
32 wellsc
Best suited for
adjacent probes and
WS-MB probes
Roche Applied
Science
LightCycler
2.0
LED
FAM, HEX, LightCycler Red 610, LightCycler
Red 640, LightCycler Red 670, and
LightCycler red 705
6 targets
32 wellsc
Best suited for
adjacent probes and
WS-MB probes
Roche Applied
Science
LightCycler
480
XL
CPM, FAM, HEX, LightCycler Red 610,
LightCycler Red 640, and Cy5
6 targets
96 wells
and
384
wellsc
All types
Stratagene
Mx3000P
THL
FAM, TMR, Texas red, and Cy5d
4 targets
96 wells
All types
Stratagene
Mx3005P
THL
FAM, HEX, TMR, Texas red, and Cy5d
5 targets
96 wells
All types
Modified from (39)
THL tungsten-halogen lamp, ABLL argon blue-light laser, LED light-emitting diode, XL xenon lamp, WS-MB wavelength-shifting molecular beacon.
aRefer to Table 17.2 for alternative fluorophores.
bEach unit is independently programmable.
cRapid cycle capabilities
dAlternative preinstalled excitation and emission filter sets are available.
High-Throughput SNP Genotyping
259

----!@#$NewPage!@#$----
exploited. A unique property of nucleic acid hybridization is its
extremely high fidelity. Such molecular interactions are the most
specific and stable known in nature. It becomes possible to moni-
tor and detect hybridization of nucleic acids if it is accompanied by
an assayable change in conformation. Two principal methods have
emerged in detecting such assayable changes in conformation. The
first, TaqMan (26), depends upon the monitoring of enzymatic
nucleic acid probe cleavage, resulting in fluorescence (see Chapters
18 and 19 for details). The second, molecular beacons (1), detects a
conformational change in the probe, which fluoresces upon hybri-
dization. We will focus principally on the use of molecular beacons.
Molecular beacons are single-stranded oligonucleotide probes
with a stem-and-loop structure (see Fig. 17.2). The loop is com-
plementary to a known sequence in a target nucleic acid sequence,
whereas the stem forms by the hybridization of the arm sequences
on either side of the loop sequence. A fluorescent moiety is cova-
lently linked to the extremity of one arm sequence and a quencher
is covalently linked to the extremity of another arm. Thus, the
fluorophore and quencher are directly juxtaposed when the stem is
formed and are in extremely close proximity to each other. This
association prevents fluorescence from being emitted from the
fluorophore. When the loop portion of the molecule encounters
a perfectly complementary target, the entire molecule undergoes a
Fig. 17.1. Comparative cost between TaqMan assays and molecular beacons. Regard-
less of the number of individuals or the number of single nucleotide polymorphisms
(SNPs) to be genotyped, the cost of molecular beacons is significantly reduced with
respect to TaqMan assays owing to the multiplexing power of molecular beacons in a
single tube. The cost for TaqMan assays is based on the prices provided by Applied
Biosystem when using 96-well plates and 25-mL PCRs. The cost of TaqMan assays can
be reduced by approximately 5–10% by performing the assays in 384-well plates and
5-mL reactions.
260
Barreiro, Henriques, and Mhlanga

----!@#$NewPage!@#$----
conformational change that results in the separation of the arms of
the stem. This causes a restoration of fluorescence to the fluoro-
phore as it is moved away from the quencher. Alterations to the
length of the probe region strongly influence the stability and
30
40
50
60
70
80
0
0.25
0.50
0.75
1.00
+
Temperature (ºC)
Wild-type-specific
molecular beacon
FAM Fluorescence
30
40
50
60
70
80
0
0.25
0.50
0.75
1.00
+
Temperature (ºC)
Mutant-specific
molecular beacon
TET Fluorescence
+
Target
CGTATGTAGTGGGATGCGCTC  GTATAAAATCGCACGCGATTCCAG
Forward Primer
Reverse Primer
Molecular Beacon
A.
B.
C.
Fig. 17.2. Principle of how molecular beacons function. (a) When the probe sequence
(loop portion) encounters a target that is perfectly complementary to it, a conformational
reorganization of the molecule occurs, resulting in a separation of the stem and the
generation of a fluorescence signal. (b) Thermal denaturation profiles of molecular
beacons when they are with wild-type or mutant targets. The wild-type target is
represented by solid lines and the mutant target is represented by dashed lines. The
absence of target is indicated by a dotted line. The conformational state of the molecular
beacon is shown directly above the line. By careful design of molecular beacons,
mismatched targets can be easily discriminated from perfectly matched targets with
‘‘windows of discrimination’’ as high as 10�C. The optimal temperature for the annealing
step from this thermal denaturation profile is found to be 50�C and therefore is used in
real-time PCR. (c) An example of how each molecular beacon, the ‘‘red’’-labeled or the
‘‘green’’-labeled, competes to hybridize to the same region depending on whether it is
perfectly complementary to the region.
High-Throughput SNP Genotyping
261

----!@#$NewPage!@#$----
specificity of the probe–target hybrid, contributing to the extreme
specificity of molecular beacons. A wide variety of differently
colored fluorophores are possible with molecular beacons (27),
thus enabling the simultaneous detection of multiple targets in the
same solution by using molecular beacons designed to detect
differing targets each labeled with a spectrally distinguishable
fluorophore.
The above-mentioned properties of molecular beacons enable
their use in monitoring the progress of nucleic acid amplification
reactions (28–32), self-reporting oligonucleotide arrays, and the
detection of messenger RNA in living cells (33–36). Molecular
beacons are especially adept at the detection of SNPs since they
recognize their targets with exquisite specificity unlike conven-
tional linear probes, owing to their hairpin structure (37). Ther-
modynamic studies where linear and stem–loop probes were
compared have revealed that this enhanced specificity is a general
feature of conformationally constrained probes such as molecular
beacons. Thus, specificity can be ‘‘tuned’’ by altering the degree to
which the probes are conformationally constrained. Practically this
involves altering the length of the stem structure in relation to the
length of the loop. In applications such as SNP detection, mole-
cular beacons can be designed to bind over a wide range of tem-
peratures such that only perfectly complementary probe–target
hybrids are formed. This keeps mismatched probes which vary by
even as much as one base unbound and dark, whereas only per-
fectly complementary probe–target hybrids elicit fluorescence.
Owing to these unique properties, the use of molecular beacons
for SNP detection has proliferated broadly as has its expansion into
a cost-effective high-throughput SNP diagnostic tool.
2. Materials
2.1. Reagents and
Equipment
1. Molecular beacon probes (see Section 3.4) designed to hybri-
dize to a target sequence carrying SNP of interest (see Note 2)
(Biosearch Technologies, http://www.biosearchtech.com).
2. Fluorescent dyes for manual linking to molecular beacons
(Glen Research or Molecular Probes/Invitrogen).
3. Black Hole quenchers (Biosearch Technologies, http://
www.biosearchtech.com).
4. Buffer I: 0.1 M sodium bicarbonate, pH 8.5.
5. Buffer II: 10 mM tris(hydroxymethyl)aminomethane (Tris)–
HCl, pH 8.0, 4 mM MgCl2, 50 mM KCl.
6. Buffer A: 0.1 M triethylammonium acetate, pH 6.5.
262
Barreiro, Henriques, and Mhlanga

----!@#$NewPage!@#$----
7. Buffer B: 0.1 M triethylamonium acetate in 75% acetonitrile,
pH 6.5.
8. Ammonium sulfate (3 M).
9. Silver nitrate (0.15 M).
10. Dithiothreitol (0.15 M).
11. Sodium bicarbonate (0.2 M), pH 9.0.
12. 1X TE buffer: 10 mM Tris–HCl, pH 7.5, 1 mM EDTA.
13. Sephadex G-25 column NAP-5 (GE/Amersham-Pharmacia).
14. Filter: 0.2-mm Centrex MF-0.4 filter (Schleicher & Schuell).
15. High-pressure liquid chromatography (HPLC) system Gold
(Beckman Coulter)
16. C-18 reverse-phase column (Waters).
17. Molecular beacon buffer: 10 mM Tris–HCl, pH 8.0, 3.5 mM
MgCl2.
18. Thermocycler, PRISM 7700 PCR system (Applied Biosystems).
19. AmpliTaq Gold DNA polymerase (Applied Biosystems).
Store at –20�C.
20. dNTP set, 100 mM solutions (Applied Biosystems). Store at
–20�C.
21. Spectrofluorometer, QuantaMaster (Photon Technology
International).
22. Haploview software program (HapMap project, http://
www.hapmap.org).
23. Zuker/mfold fold software program (http://www.bioinfo.
rpi.edu/applications/mfold/).
2.2. Synthesis of
Molecular Beacons
Significant advances have been made in solid-phase chemistry
enabling the routine synthesis of nucleic acids coupled to fluor-
ophore and quencher moieties (38). Almost all organic dyes that
are routinely used in the visible and infrared light range are
available as phosphoramidites, which can be coupled to nucleic
acid oligomers during routine syntheses. This is also true for
quenchers. For complex syntheses and nonstandard molecular
beacons, it is also possible to use manual coupling approaches.
This is done by using oligonucleotides which contain either
amino or sulfahydryl functional groups at either their 50-ends
or their 30-ends. By using succinimidyl ester, iodoacetamide
derivatives, or maleimide derivatives of the fluorophores and
quenchers, one can couple most commercially available dyes
and quenchers to oligonucleotides possessing either amino or
sulfahydryl functional groups. In Section 3.1 and 3.2 we
describe
a
protocol
for
manual
synthesis
of
modified
oligonucleotides.
High-Throughput SNP Genotyping
263

----!@#$NewPage!@#$----
2.3. Matching the
Fluorophore to the
Instrument
With the emergence of real-time PCR as a standard instrument in
most laboratories, a number of instruments with differing capabil-
ities have become available. For high-throughput applications
such as SNP typing, the principal considerations should be multi-
plexing abilities, throughput (number of wells), and to a certain
extent cycling speed. Spectral overlap is minimized with molecular
beacons since they are quenched when unbound. In addition,
several instruments (Table 17.1) are able to detect up to six
spectrally distinguishable dyes (Table 17.2), routinely enabling
extremely powerful multiplexing capabilities.
Table 17.2
Fluorophore labels for fluorescent hybridization probes
Fluorophore
Alernative fluorophore
Excitation
(nm)
Emission
(nm)
Coumarin
Biosearch Bluea, LightCycler Cyan 500b
430
475
FAM
495
515
TET
CAL Fluor Gold 540a
525
540
HEX
ATTO 532c, CAL Fluor Orange 560a,
JOE, VICd
535
555
Cy3
NEDd, Oyster 556f, Quasar 570a
550
570
TMR
Alexa 546g, CAL Fluor Red 590a
555
575
ROX
Alexa 568g, CAL Fluor Red 610a,
LightCycler Red 610b
575
605
Texas red
Alexa 594g, CAL Fluor Red 610a,
LightCycler Red 610b
585
605
LightCycler
Red 640
CAL Fluor Red 635a
625
640
Cy5
ATTO 647 Nc, LC Red 670b,
Oyster 645f, Quasar 670a
650
670
LightCycler
Red 705
Cy5.5e, Quasar 705a
680
710
Modified from (39)
aBiosearch Blue, CAL, and Quasar fluorophores are available from Biosearch Technologies.
bLightCycler fluorophores are available from Roche Applied Science.
cATTA dyes are available from ATTO-TEC.
dVIC and NED fluorophores are available from Applied Biosystems.
eCyanine dyes are available from Amersham Biosciences.
fOyster fluorophores are available from Integrated DNA Technologies.
gAlexa fluorophores are available from Invitrogen.
264
Barreiro, Henriques, and Mhlanga

----!@#$NewPage!@#$----
To run this application one would need to have one of the
instruments described in Table 17.1. The choice of the instru-
ment depends on the task and the dyes to be used.
3. Methods
3.1. Coupling of
Quencher
1. Dissolve 50–250 nmol of dry (commercially obtained or
custom-made) oligonucleotide in 500 mL of buffer I. In
DMSO dissolve approximately 20 mg succinimidyl ester
coupled quencher and add it to a stirring solution of the
oligonucleotide in 10-mL aliquots at 20-min intervals. Con-
tinue stirring for at least 12 h. Perform this reaction in the
dark (see Note 1). We recommend the Black Hole family of
quenchers that are available in three variants dependent on
the desired wavelength for quenching (see Section 2.2).
2. Remove particulate material by spinning the mixture in a
microcentrifuge for 1 min at 16,000 g. To remove unreacted
quencher, pass the supernatant through a gel-exclusion col-
umn. Equilibrate a Sephadex G-25 column with buffer A,
load the supernatant, and elute the contents of the column
with 1 mL of buffer A. Filter the eluate through a 0.2-mm
Centrex MF-0.4 filter.
3. Purify the oligonucleotides by HPLC on a C-18 reverse-phase
column, utilizing a linear elution gradient of 20–70% buffer B
in buffer A and run the elution for 25 min at a flow rate of
1 mL/min. Monitor the absorption of the elution stream at
260 nm and the specific quencher absorption maximum. Col-
lect the eluate that absorbs at both wavelengths, and that
therefore contains oligonucleotides with a protected sulfhydryl
group at their 50-ends and the quencher at their 30-ends.
4. Precipitate the collected material with ethanol and 3 M
ammonium sulfate, and spin the precipitate in a centrifuge
for 10 min at 16,000g, discard the supernatant, dry the pellet,
and dissolve it in 250 mL of buffer A.
3.2. Coupling of
Fluorophore
1. To remove the trityl moiety, add 10 mL of 0.15 M silver
nitrate and incubate the solution for 30 min. Add 15 mL
of 0.15 M dye to this mixture and shake the mixture for
5 min. Spin the mixture for 2 min at 16,000g and transfer
the supernatant to a new tube. Dissolve about 40 mg og
5-iodoactamido-reactive fluorophore in 250 mL of 0.2 M
sodium bicarbonate, pH 9.0, and add it to the supernatant.
Incubate the mixture for 90 min. Each of these solutions
should be prepared just before use.
High-Throughput SNP Genotyping
265

----!@#$NewPage!@#$----
2. Removeexcessuncoupledfluorophorefromthereactionmixture
bygel-exclusionchromatographyandpurifytheoligonucleotides
coupled to the fluorophore by HPLC, following the instructions
in steps 2 and 3 in Section 3.1. Collect the fractions that absorb
with a peak at 260 nm and at the specific fluorophore absorption
maximum. This eluate should be fluorescent when observed with
an ultraviolet lamp in a dark room.
3. Precipitate the collected material and dissolve the pellet in
100 mL 1X TE buffer. Determine the absorbance at 260 nm
and estimate the yield (1 OD260 = 33 ng/mL). Store the
purified molecular beacon for long-term storage in lyophi-
lized form at –80�C (see Notes 1 and 2).
3.3. Characterization of
Molecular Beacons
3.3.1. Signal-to-
Background Ratio
1. Determine the fluorescence of 200 mL of molecular beacon
buffer solution (Fbuffer), using 491 nm as the excitation wave-
length and the emission wavelength of the fluorophore used
(Fig. 17.3).
2. Add 10 mL of 1 mM molecular beacon to this solution and
record the new level of fluorescence (Fclosed).
3. Add a twofold molar excess of a complementary oligonucleo-
tide target and monitor the rise in fluorescence until it reaches
a stable level (Fopen).
4. Calculate the signal-to-background ratio as (Fopen-Fbuffer)/
(Fclosed-Fbuffer).
0
10000
20000
30000
40000
50000
60000
70000
80000
0
50
100
150
200
Time (sec)
Fluorescence (CPS)
buffer [Fbuffer]
add molecular beacon [Fclosed]
add target [Fopen]
Fig. 17.3. Spectrofluorometric characterization of molecular beacons. The molecular
beacons are functionally characterized in the presence of perfectly complementary
oligonucleotide. Here a 30-fold increase is observed.
266
Barreiro, Henriques, and Mhlanga

----!@#$NewPage!@#$----
3.3.2. Thermal
Denaturation Profiles
1. Prepare two tubes containing 50 mL of 200 nM molecular
beacon dissolved in molecular beacon buffer solution and add
the oligonucleotide target to one of the tubes at a final con-
centration of 400 nM (see Fig. 17.2).
2. Determine the fluorescence of each solution as a function of
temperature using a spectrofluorometric thermal cycler (see
Table 17.1). Decrease the temperature of these tubes from
80 to 10�C in 1�C steps, with each hold lasting 1 min, while
monitoring the fluorescence during each hold (see Fig. 17.2).
3.4. Design of Primers
and Molecular Beacons
for SNP Detection
The design of molecular beacons for SNP detection is at times
challenging since the flexibility in the targeting region to be
detected is virtually nil. The region where the SNP of interest
occurs must be targeted and molecular beacons with as little as
one base variant from this region must not bind under amplifica-
tion conditions. To satisfy these constraints, the loop portion of
the probe is made to be not more than 25 nucleotides in length. As
a rule of thumb, the shorter the length of the loop, the more highly
discriminating the probe will be. Care must be taken to ensure that
the melting temperature of the probe–target hybrid is compatible
with the annealing temperature of primers during PCR. With this
part of the design complete, stem/arm sequences can be designed
that allow the stem to dissociate at about 7–10�C above the
annealing temperature of the primers during PCR. This design
process is made more complex in certain examples where multiple
primers are used in a single tube (as in the example given later in
this chapter). The challenge when doing multiplex PCR is to
optimize all the primers for all the PCRs first. This ensures that
all primers make good amplicons at the same temperature. Mole-
cular beacons can then be designed to be SNP-discriminating at
the annealing temperature of the primers by alterations in loop
size. It is always useful to verify the secondary structure of the
designed molecular beacon to ensure that it does not contain
secondary structures that restrict the loop from binding to a
PCR target. The preferred program for nucleic acid secondary
structure prediction is Zuker/mfold fold (http://www.bioinfo.
rpi.edu/applications/mfold/). For extremely difficult situations
where design for AT- or GC-rich regions makes the stability of
annealing variable, this can be circumvented by a number of stra-
tegies such as sliding the loop region so the SNP is no longer at its
center. A second strategy is to include the stem/arm sequences in
the binding sequence so as to create an even more stable hybrid
(this could be useful in AT-rich regions). Lastly, if these strategies
prove unsuccessful, an additional annealing step for the purposes
of detection can be programmed into the thermal cycling profile.
This step can be designed to occur at a temperature where it is
easier to meet SNP discrimination constraints with the molecular
High-Throughput SNP Genotyping
267

----!@#$NewPage!@#$----
3838A
4235G 3933G
3838C
4235C
3933A
DC
SIGN
Tube 3
–939G
–871A –336A
–939A
–871G –336G
DC
SIGN
Tube 1
–139A
2392G
3220T
–139G
2392A
3220C
DC
SIGN
Tube 2
FAM
TET
Atto 532
Alexa 546
Alexa 568
Alexa 594
C
C
G
G
H9
C
A
G
G
H8
C
G
G
H7
A
G
G
H6
G
G
H5
H4
G
G
A
H3
G
A
H2
C
G
A
H1
G
G
A
T
G
A
A
A
G
3933G>A
4235G>C
3838A>C
3220T>C
2392G>A
-139A>G
-336A>G
-871A>G
-939G>A
Allele 2
Allele 1
Homozygous
(major)
Heterozygous
Homozygous
(minor)
8.93
10.71
8.93
28.57
5.36
5.36
5.36
5.36
7.14
Freq. (%)
Protective
Haplotype
A.
B.
C.
Fig. 17.4. High-throughput SNP scoring of the DC-SIGN locus. (a) Eighteen molecular beacons and corresponding primers
were designed to score the major and minor alleles of nine ‘‘tag’’ SNPs of the DC-SIGN locus. Each major and minor SNP
allele had a molecular beacon labeled in a spectrally distinct color. This means that in instruments where up to six colors
are spectrally distinguishable, it is possible to simultaneously detect up to six major and/or minor alleles. To score
268
Barreiro, Henriques, and Mhlanga

----!@#$NewPage!@#$----
beacons designed. It can also potentially result in false priming so
it is not a preferred approach. For detailed instructions on the
general design of molecular beacons for SNP detection, see
(29,32).
PCR primers were designed that consistently amplified
regions no greater than 250 base pairs. Those design rules were
followed to make the probes and primers shown in (see Fig. 17.4).
The dedicated software package Beacon Builder (Premier Biosoft
International) can be used for the design of similar molecular
beacons. The window of discrimination outlined in Fig. 17.4
should be carefully studied and respected in designing molecular
beacons to detect SNPs.
3.5. Real-Time PCR
1. Prepare a 50-mL (or as little as 5-mL) reaction that contains
100 nM major allele specific molecular beacon, 100 nM
minor allele specific molecular beacon, 500 nM concentration
of each primer, at least 1 unit of AmpliTaq Gold DNA poly-
merase, and 250 mM concentration of each type of dNTP,
dissolved in buffer II.
2. Run the PCR. The thermal cycle for most of the machines
described in Table 17.1 should be 10 min at 95�C followed
by 35–40 cycles at 30 s at 95�C, 45 s at 50�C (or a tempera-
ture which is compatible with the window of discrimination),
and 30 s at 72�C. The fluorescence should be monitored at
the appropriate channel during the 50�C annealing step (see
Notes 3, 4 and 5).
3.6. Data Analysis in a
Case Study Using Tag
SNPs (High-
Throughput SNP
Scoring of the DC-SIGN
Locus)
In human genetics, association studies aim to identify loci that
contribute to disease susceptibility by comparing patterns of
genetic variation between people with a disease (cases) and those
without (controls). As mentioned earlier, several studies have
revealed an interesting feature present in the structure of human
genetic variation that can be utilized to dramatically reduce the
Fig. 17.4. (continued) each of the alleles in a given individual, three PCR amplifications were set up with the appropriate
primers (not shown) that all annealed at a similar temperature. At each annealing step, depending on the presence or
absence of a particular allele, a given molecular beacon would fluoresce. By ‘‘scoring’’ the data for each tube, one can
determine, for each individual the specific genotype for each of the nine tag SNPs. (b) The three possibilities for a given
SNP locus, either a single major or a single minor allele is present, in which case a homozygous result is obtained and only
a single color is observed. Alternatively, both alleles are observed, indicating that the locus is a heterozygote.
(c) Haplotypes observed for the combination of these nine tag SNPs in the Cape Town population. The frequencies
reported correspond to the frequencies observed for each of these haplotypes in the Cape Town population independent of
their disease status. An association was observed between two DC-SIGN promoter variants (-871G and -336A) and
decreased risk of developing tuberculosis. Haplotype 3 turned out to be the best predictor of an increased resistance
to tuberculosis, at least in the South African population. This haplotype, which contains both -871G and -336A, was found
to be more frequently observed in the control group than in people who developed tuberculosis (8.9% vs. 14.2% p =
1.6 � 10�3; odds ratio 1.7; 95% confidence interval 1.22–2.38.
High-Throughput SNP Genotyping
269

----!@#$NewPage!@#$----
cost of association studies (11, 40–43). Specifically, alleles at
nearby loci often show strong statistical association (i.e., LD).
This can be exploited to design a powerful and cost-effective way
to perform association studies by using tag SNPs for a region of
interest, i.e., by determining which loci within that region capture
the majority of the diversity.
In this section we outline a study of the DC-SIGN gene.
By using the unique multiplexing power of molecular beacons
in a high-throughput assay, we are able to genotype nine tag
SNPs thereby obtaining information from 54 SNPs. Thus,
with three tubes per individual and with three pairs of mole-
cular beacons per tube, we are able to score all the informa-
tion of 54 SNPs.
DC-SIGN is an innate immunity gene that belongs to the
C-type lectin family. C-type lectins are calcium-dependent car-
bohydrate-binding proteins with a wide range of biological func-
tions, many of which are related to immunity (44). DC-SIGN as
well as its homolog L-SIGN are particularly interesting, since
they can act as both cell-adhesion receptors and pathogen-
recognition receptors (45). DC-SIGN was originally cloned for
its ability to bind and internalize the heavily glycosylated HIV
gp120 protein (46). DC-SIGN strongly binds all HIV and simian
immunodeficiency virus strains examined to date and plays an
important role in virus adhesion to dendritic cells (47, 48). These
studies have paved the way for further investigations into inter-
actions between DC-SIGN and other pathogens and it has now
become clear that this lectin recognizes a vast range of microbes,
some of which are of major public health importance (48).
Indeed, DC-SIGN captures bacteria such as Mycobacterium
tuberculosis, Mycobacterium leprae, Helicobacter pylori, and cer-
tain Klebsiela pneumonia strains; viruses such as HIV-1, Ebola
virus, cytomegalovirus, hepatitis C virus, Dengue virus, and
SARS coronavirus; and parasites such as Leishmania pifanoi and
Schistosoma mansoni (47, 49–59).
In light of the ability of DC-SIGN to interact with a large
plethora of pathogens, it is plausible that variation in its gene
may influence the pathogenesis of a number of infectious dis-
eases. Indeed, multiple association studies have shown a rela-
tionship between genetic variants in the promoter region of
DC-SIGN and susceptibility to several infectious diseases. Spe-
cifically, it has been shown that two promoter variants, -871G
and -336A, confer protection against tuberculosis. Similarly, the
-336A variant has been reported to protect against parental
HIV infection and to influence the severity of dengue patho-
genesis (60, 61). More recently, two other promoter variants,
–139A/G and –939G/A, showed a significant association with
an increased risk of developing human cytomegalovirus reacti-
vation and disease (60).
270
Barreiro, Henriques, and Mhlanga

----!@#$NewPage!@#$----
How can one efficiently test for an association between DC-
SIGN variation and susceptibility to disease? Imagine that you
want to explore the relationship between DC-SIGN polymorph-
isms and susceptibility to tuberculosis (62). The best way to do so
is to follow the strategy described below:
1. Collect a cohort, from the same population (see Note 6), that
includes a group of individuals that developed tuberculosis
(i.e., cases) and a group of matched individuals that did not
develop the disease (i.e., controls). Ideally, one would need/
like to fully resequence DC-SIGN in the entire cohort to
obtain the full extent of diversity present in cases and controls.
Nevertheless, full resequencing approaches are unacceptably
expensive and time consuming and, therefore, the most
powerful and cost-effective way to perform association studies
is by defining tag SNPs for a region of interest (see Section
17.1 for details). To do so, you have two alternatives:
(a) Begin by fully resequencing the region under study in a
subset of your cohort. Typically 20–30 individuals should
be enough to capture the most common haplotypes in the
population. After haplotype reconstruction (see Note 7)
and on the basis of the LD patterns observed, you can
then identify the set of SNPs best able to characterize the
diversity observed (i.e., tag SNPs) (see Note 8).
(b) Use publicly available datasets to identify tag SNPs. The
best available resource to choose tag SNPs is the HapMap
data. Go to the HapMap Web site (http://www.hapma
p.org) and using the genome browser retrieve genotypic
data for all the SNPs that have been typed for the region
you are interested in; in this case DC-SIGN. Then, upload
the data in Haploview (a free software program provided
by the HapMap consortium) and run Tagger to identify
tag SNPs for your region (see Note 7). The current limita-
tion of using HapMap is that the data are restricted to
three human populations – the samples came from an
African population from Nigeria (Yoruba; N ¼ 90), a
mostly Utah (USA) population of European ancestry
(N ¼ 90), and a sample drawn from Japanese (N ¼ 45)
and Han Chinese (N ¼ 45) populations. If your popula-
tion is genetically distinct from these HapMap popula-
tions, you will have to follow the resequencing strategy;
as the tag SNPs identified using HapMap populations
might differ from those characterizing the diversity of
your study-population.
2. Once you have identified the set of SNPs best able to char-
acterize the full diversity observed in your population, the
next step is to genotype these tag SNPs in the entire cohort.
High-Throughput SNP Genotyping
271

----!@#$NewPage!@#$----
In Fig. 17.4 we present an example of a haplotyping
approach scoring tag SNPs in a high-throughput assay using
molecular beacons to easily test for an association between
DC-SIGN variation and susceptibility to infectious diseases.
This example is based on a previous study that explored the
relationship between DC-SIGN polymorphisms and suscept-
ibility to tuberculosis (63). The authors showed that nucleo-
tide variation in the DC-SIGN promoter region is associated
with susceptibility to tuberculosis. Specifically they identified
a specific haplotype (Fig. 17.4) associated with decreased risk
of developing tuberculosis (63).
4. Notes
1. Molecular beacons deteriorate as they are exposed to light.
Therefore, avoid exposure to light whenever possible. Mole-
cular beacons should be stored in aluminum-foil-wrapped test
tubes at –20�C and preferably at –80�C in lyophilized form.
When preparing them for use, one can resuspended them in
TE buffer.
2. Since most oligonucleotide manufacturers worldwide can
provide molecular beacons with all these functionalities,
obtaining molecular beacons with diverse fluorophore and
quencher combinations has become routine. These suppliers
can be found at http://www.molecular-beacons.org.
3. At times, false amplicons may appear during PCR and may
appear if the sensitivity of the PCR is reduced. Two
approaches can be used to circumvent this. Firstly, DNA
polymerases that are active only after activation at 95�C can
be used. Secondly, paying careful attention to the design of
primers that function well within the ‘‘window of discrimina-
tion’’ is recommended.
4. The real-time PCR machines and fluorescent dyes proposed
in Table 17.1 and 17.2 are fairly good at discriminating
between the proposed dyes. Thus, if poor discrimination is
observed between major and minor alleles, tweaks to the
primers and annealing temperatures can be made that permit
more stringent discrimination. If these are unsuccessful, mod-
ifications to the molecular beacons themselves can be made.
One modification is to increase the length of the molecular
beacon stem to promote stability and increase stringency.
A second modification is to use 20-O-methyl molecular bea-
cons, which intrinsically have a higher melting temperature
than DNA-based molecular beacons. However 20-O-methyl
272
Barreiro, Henriques, and Mhlanga

----!@#$NewPage!@#$----
molecular beacons are more expensive to synthesize. Third,
the stem sequence of the molecular beacon can be designed to
also bind to the amplicon.
5. Amplicon size has a very important influence on the fluores-
cence signal obtained with molecular beacons. Thus, it is impor-
tant to design PCRs where amplicons do not exceed 250 bp.
6. It is important that the groups of cases and controls are geneti-
cally matched, as population stratification between cases and
controls can be a confounding factor leading to a spurious
positive association. This will be particularly harmful if cases
and controls are from different populations, but also in
admixed populations (e.g. CAP population from South Africa).
Indeed, the use of admixed populations in association-mapping
studies can be very useful for identification of disease-causing
genetic variants that differ in frequency across parental popula-
tions. However, when the admixture event is too recent, allelic
frequencies can differ coincidentally among cases and controls,
reflecting a nonuniform genetic contribution from the parental
populations to each subpopulation (i.e., cases and controls),
rather than a genuine association between a given genetic
variant and the phenotype under study. In this case, the study
cohort is said to present population stratification.
7. To reconstruct haplotypes we recommend the Bayesian
statistical method implemented in Phase version 2.1.162
(64). Alternatively, you can use the accelerated expectation
maximization algorithm implemented in Haploview version
3.163 (65). At least for regions with high levels of LD, both
algorithms should give similar results.
8. Tag SNPsfor each population can be selected using Haplo-
view’s Tagger in pairwise tagging mode (r2 � 0.80, minor
allele frequency cutoff 5%, and other settings at default value).
References
1. Tyagi, S. and Kramer, F. R. (1996) Molecu-
lar beacons: probes that fluoresce upon
hybridization. Nat. Biotechnol. 14, 303–308.
2. Tyagi, S. (2000) DNA Probes, In Encyclo-
pedia of Analytical Chemistry: Applications,
Theory and Instrumentation (Meyers, R. A.,
Ed.) John Wiley & Sons Ltd. Chichester,
UK, Vol. 6, pp. 4911.
3. Lander, E. S., Linton, L. M., Birren, B. et al.
(2001) Initial sequencing and analysis of the
human genome. Nature 409, 860–921.
4. Sachidanandam, R., Weissman, D., Schmidt,
S. C. et al. (2001) A map of human genome
sequence variation containing 1.42 million
single nucleotide polymorphisms. Nature
409, 928–933.
5. Hinds, D. A., Stuve, L. L., Nilsen, G.
B. et al. (2005) Whole-genome pat-
terns
of
common
DNA
variation
in
three human populations. Science 307,
1072–1079.
6. Miller, R. D., Phillips, M. S., Jo, I. et al.
(2005)
High-density
single-nucleotide
polymorphism maps of the human genome.
Genomics 86, 117–126.
7. Kruglyak, L. and Nickerson, D. A. (2001)
Variation is the spice of life. Nat. Genet. 27,
234–236.
High-Throughput SNP Genotyping
273

----!@#$NewPage!@#$----
8. Miller, R. D. and Kwok, P. Y. (2001) The
birth and death of human single-nucleotide
polymorphisms: new experimental evidence
and implications for human history and med-
icine. Hum. Mol. Genet. 10, 2195–2198.
9. Crawford, D. C., Akey, D. T. and Nickerson,
D. A. (2005) The patterns of natural varia-
tion in human genes. Annu. Rev. Genomics
Hum. Genet. 6, 287–312.
10. Consortium TIH. (2003) The International
HapMap Project. Nature 426, 789–796.
11. Consortium TIH. (2005) A haplotype map
of
the
human
genome.
Nature
437,
1299–1320.
12. Frazer, K. A., Ballinger, D. G., Cox, D. R.
et al. (2007) A second generation human
haplotype map of over 3.1 million SNPs.
Nature 449, 851–861.
13. Conrad, D. F., Jakobsson, M., Coop, G. et al.
(2006) A worldwide survey of haplotype var-
iation and linkage disequilibrium in the
human genome. Nat. Genet. 38, 1251–1260.
14. Gonzalez-Neira, A., Ke, X., Lao, O. et al.
(2006) The portability of tagSNPs across
populations: a worldwide survey. Genome
Res. 16, 323–330.
15. Eberle, M. A., Ng, P. C., Kuhn, K. et al.
(2007) Power to detect risk alleles using
genome-wide tag SNP panels. PLoS Genet.
3, 1827–1837.
16. Consortium TWTCC. (2007) Genome-
wide association study of 14,000 cases of
seven common diseases and 3,000 shared
controls. Nature 447, 661–678.
17. Todd, J. A., Walker, N. M., Cooper, J. D.
et al. (2007) Robust associations of four new
chromosome regions from genome-wide
analyses of type 1 diabetes. Nat. Genet. 39,
857–864.
18. Saxena, R., Voight, B. F., Lyssenko, V. et al.
(2007) Genome-wide association analysis
identifies loci for type 2 diabetes and trigly-
ceride levels. Science 316, 1331–1336.
19. Zeggini, E., Weedon, M. N., Lindgren, C.
M. et al. (2007) Replication of genome-
wide association signals in UK samples
reveals risk loci for type 2 diabetes. Science
316, 1336–1341.
20. Samani, N. J., Erdmann, J., Hall, A. S. et al.
(2007) Genomewide association analysis of
coronary artery disease. N. Engl. J. Med.
357, 443–453.
21. Frayling, T. M., Timpson, N. J., Weedon,
M. N. et al. (2007) A common variant in the
FTO gene is associated with body mass
index and predisposes to childhood and
adult obesity. Science 316, 889–894.
22. Scuteri, A., Sanna, S., Chen, W. M. et al.
(2007)
Genome-wide
association
scan
shows genetic variants in the FTO gene are
associated with obesity-related traits. PLoS
Genet. 3, e115.
23. Thomson, W., Barton, A., Ke, X. et al.
(2007) Rheumatoid arthritis association at
6q23. Nat Genet 39, 1431–1433.
24. Fellay, J., Shianna, K. V., Ge, D. et al.
(2007) A whole-genome association study
of major determinants for host control of
HIV-1. Science 317, 944–947.
25. Leone, G., van Schijndel, H., van Gemen,
B., Kramer, F. R. and Schoen, C. D. (1998)
Molecular beacon probes combined with
amplification by NASBA enable homoge-
neous, real-time detection of RNA. Nucleic
Acids Res. 26, 2150–2155.
26. Livak, K. J. (1999) Allelic discrimination
using fluorogenic probes and the 50 nuclease
assay. Genet. Anal. 14, 143–149.
27. Tyagi, S., Bratu, D. P. and Kramer, F. R.
(1998) Multicolor molecular beacons for
allele discrimination. Nat. Biotechnol. 16,
49–53.
28. El-Hajj, H. H., Marras, S. A., Tyagi, S.,
Kramer, F. R. and Alland, D. (2001) Detec-
tion of rifampin resistance in Mycobacter-
ium tuberculosis in a single tube with
molecular beacons. J. Clin. Microbiol. 39,
4131–4137.
29. Marras, S. A., Kramer, F. R. and Tyagi, S.
(2003) Genotyping SNPs with molecular
beacons. Methods Mol. Biol. 212, 111–128.
30. Vet, J. A., Majithia, A. R., Marras, S. A. et al.
(1999) Multiplex detection of four patho-
genic retroviruses using molecular beacons.
Proc.
Natl.
Acad.
Sci.
U.S.A.
96,
6394–6399.
31. Kostrikis, L. G., Tyagi, S., Mhlanga, M. M.,
Ho, D. D. and Kramer, F. R. (1998) Spec-
tral genotyping of human alleles. Science
279, 1228–1229.
32. Mhlanga, M. M. and Malmberg, L. (2001)
Using molecular beacons to detect single-
nucleotide polymorphisms with real-time
PCR. Methods 25, 463–471.
33. Bratu, D. P., Cha, B. J., Mhlanga, M. M.,
Kramer, F.R. and Tyagi, S. (2003) Visualiz-
ing
the
distribution
and
transport
of
mRNAs in living cells. Proc. Natl. Acad.
Sci. U.S.A. 100, 13308–13313.
34. Mhlanga, M. M., Vargas, D. Y., Fung, C.
W., Kramer, F. R. and Tyagi, S. (2005)
tRNA-linked molecular beacons for imaging
mRNAs in the cytoplasm of living cells.
Nucleic Acids Res. 33, 1902–1912.
274
Barreiro, Henriques, and Mhlanga

----!@#$NewPage!@#$----
35. Tyagi, S. and Alsmadi, O. (2004) Imaging
native beta-actin mRNA in motile fibro-
blasts. Biophys. J. 87, 4153–4162.
36. Vargas, D. Y., Raj, A., Marras, S. A., Kramer,
F. R. and Tyagi, S. (2005) Mechanism of
mRNA transport in the nucleus. Proc. Natl.
Acad. Sci. U.S.A. 102, 17008–17013.
37. Bonnet, G., Tyagi, S., Libchaber, A. and
Kramer, F. R. (1999) Thermodynamic
basis of the enhanced specificity of struc-
tured DNA probes. Proc. Natl. Acad. Sci.
U.S.A. 96, 6171–6176.
38. Lee, L. G., Livak, K. J., Mullah, B., Graham,
R. J., Vinayak, R.S. and Woudenberg T. M.
(1999) Seven-color, homogeneous detec-
tion of six PCR products. Biotechniques 27,
342–349.
39. Marras, S. A. (2008) Interactive fluoro-
phore and quencher pairs for labeling fluor-
escent nucleic acid hybridization probes.
Mol. Biotechnol. 38, 247–255.
40. Daly, M. J., Rioux, J. D., Schaffner, S. F.,
Hudson, T. J. and Lander, E. S. (2001)
High-resolution haplotype structure in the
human genome. Nat. Genet. 29, 229–232.
41. Dawson, E., Abecasis, G. R., Bumpstead, S.
et al. (2002) A first-generation linkage dis-
equilibrium map of human chromosome 22.
Nature 418, 544–548.
42. Gabriel, S. B., Schaffner, S. F., Nguyen, H.
et al. (2002) The structure of haplotype
blocks in the human genome. Science 296,
2225–2229.
43. Reich, D. E., Cargill, M., Bolk, S. et al.
(2001)
Linkage
disequilibrium
in
the
human genome. Nature 411, 199–204.
44. Zelensky, A. N. and Gready, J. E. (2005)
The C-type lectin-like domain superfamily.
FEBS J. 272, 6179–6217.
45. Soilleux, E. J. (2003) DC-SIGN (dendritic
cell-specific ICAM-grabbing non-integrin)
and DC-SIGN-related (DC-SIGNR): friend
or foe? Clin. Sci. (Lond) 104, 437–446.
46. Curtis, B. M., Scharnowske, S. and Watson,
A. J. (1992) Sequence and expression of a
membrane-associated
C-type
lectin
that
exhibits
CD4-independent
binding
of
human immunodeficiency virus envelope
glycoprotein gp120. Proc. Natl. Acad. Sci.
U. S. A. 89, 8356–8360.
47. Geijtenbeek, T. B., Kwon, D. S., Torensma,
R. et al. (2000) DC-SIGN, a dendritic cell-
specific HIV-1-binding protein that enhances
trans-infection of T cells. Cell 100, 587–597.
48. Geijtenbeek, T. B., van Vliet, S. J., Enger-
ing, A., Hart, B. A. and van Kooyk, Y.
(2004) Self- and nonself-recognition by
C-type lectins on dendritic cells. Annu.
Rev. Immunol. 22, 33–54.
49. Alvarez, C. P., Lasala, F., Carrillo, J., Muniz,
O., Corbi, A. L. and Delgado, R. (2002)
C-type lectins DC-SIGN and L-SIGN med-
iate cellular entry by Ebola virus in cis and in
trans. J. Virol. 76, 6841–6844.
50. Appelmelk, B. J., van Die, I., van Vliet, S. J.,
Vandenbroucke-Grauls, C. M., Geijten-
beek, T. B. and van Kooyk, Y. (2003) Cut-
ting edge: carbohydrate profiling identifies
new pathogens that interact with dendritic
cell-specific ICAM-3-grabbing nonintegrin
on
dendritic
cells.
J.
Immunol.
170,
1635–1639.
51. Barreiro, L. B., Quach, H., Krahenbuhl, J.
et al. (2006) DC-SIGN interacts with
Mycobacterium leprae but sequence varia-
tion in this lectin is not associated with
leprosy in the Pakistani population. Hum.
Immunol. 67, 102–107.
52. Bergman, M. P., Engering, A., Smits, H. H.
et al. (2004) Helicobacter pylori modulates
the T helper cell 1/T helper cell 2 balance
through phase-variable interaction between
lipopolysaccharide and DC-SIGN. J. Exp.
Med. 200, 979–990.
53. Colmenares, M., Puig-Kroger, A., Pello, O.
M., Corbi, A. L. and Rivas L. (2002)
Dendritic cell (DC)-specific intercellular
adhesion molecule 3 (ICAM-3)-grabbing
nonintegrin (DC-SIGN, CD209), a C-type
surface lectin in human DCs, is a receptor
for Leishmania amastigotes. J. Biol. Chem.
277, 36766–36769.
54. Geijtenbeek, T. B., Van Vliet, S. J., Koppel,
E. A. et al. (2003) Mycobacteria target DC-
SIGN to suppress dendritic cell function.
J. Exp. Med. 197, 7–17.
55. Halary, F., Amara, A., Lortat-Jacob, H. et al.
(2002) Human cytomegalovirus binding to
DC-SIGN is required for dendritic cell
infection and target cell trans-infection.
Immunity 17, 653–664.
56. Lozach, P. Y., Lortat-Jacob, H., de Lacroix
de Lavalette, A. et al. (2003) DC-SIGN and
L-SIGN are high affinity binding receptors
for hepatitis C virus glycoprotein E2. J. Biol.
Chem. 278, 20358–20366.
57. Marzi, A., Gramberg, T., Simmons, G. et al.
(2004) DC-SIGN and DC-SIGNR interact
with the glycoprotein of Marburg virus
and the S protein of severe acute respiratory
syndrome
coronavirus.
J.
Virol.
78,
12090–12095.
58. Tailleux, L., Schwartz, O., Herrmann, J. L.
et
al. (2003)
DC-SIGN
is the
major
High-Throughput SNP Genotyping
275

----!@#$NewPage!@#$----
Mycobacterium tuberculosis receptor on
human dendritic cells. J. Exp. Med. 197,
121–127.
59. Tassaneetrithep, B., Burgess, T. H., Granelli-
Piperno, A. et al. (2003) DC-SIGN (CD209)
mediates dengue virus infection of human
dendritic cells. J. Exp. Med. 197, 823–829.
60. Martin, M. P., Lederman, M. M., Hutcheson,
H. B. et al. (2004) Association of DC-SIGN
promoter polymorphism with increased risk
for parenteral, but not mucosal, acquisition
of
human
immunodeficiency
virus
type
1 infection. J. Virol. 78, 14053–14056.
61. Sakuntabhai, A., Turbpaiboon, C., Casade-
mont, I. et al. (2005) A variant in the CD209
promoter is associated with severity of den-
gue disease. Nat. Genet. 37, 507–513.
62. Mezger, M., Steffens, M., Semmler, C. et al.
(2008) Investigation of promoter variations
in dendritic cell-specific ICAM3-grabbing
non-integrin (DC-SIGN) (CD209) and
their relevance for human cytomegalovirus
reactivation and disease after allogeneic
stem-cell transplantation. Clin. Microbiol.
Infect. 14, 228–234.
63. Barreiro, L. B., Neyrolles, O., Babb, C. L.
et al. (2006) Promoter variation in the DC-
SIGN-encoding gene CD209 is associated
with tuberculosis. PLoS Med. 3, e20.
64. Stephens, M. and Donnelly, P. A. (2003)
comparison of bayesian methods for haplo-
type reconstruction from population geno-
type
data.
Am.
J.
Hum.
Genet.
73,
1162–1169.
65. Barrett, J. C., Fry, B., Maller, J. and Daly,
M. J. (2005) Haploview: analysis and visua-
lization of LD and haplotype maps. Bioin-
formatics 21, 263–265.
276
Barreiro, Henriques, and Mhlanga