Hierarchies of Host Factor Dynamics at the Entry Site of Shigella
flexneri during Host Cell Invasion
Soudeh Ehsani,a José Carlos Santos,a,b Cristina D. Rodrigues,a Ricardo Henriques,c Laurent Audry,a Christophe Zimmer,c
Philippe Sansonetti,d,e Guy Tran Van Nhieu,f,g and Jost Enningaa
Group Dynamics of Host-Pathogen Interactions, Institut Pasteur, Paris, Francea; Doctoral Program in Areas of Basic and Applied Biology (GABBA), Universidade do Porto,
Porto, Portugalb; Group Imagerie et Modélisation, Institut Pasteur, Paris, Francec; Unit Pathogénie Microbienne Moléculaire, Institut Pasteur, Paris, Franced; INSERM Unit
789, Paris, Francee; Interdisciplinary Research Group Intercellular Communication of Microbial Infection, College de France, Paris, Francef; and INSERM Unit 1050, Paris,
Franceg
Shigella flexneri, the causative agent of bacillary dysentery, induces massive cytoskeletal rearrangement, resulting in its entry
into nonphagocytic epithelial cells. The bacterium-engulfing membrane ruffles are formed by polymerizing actin, a process acti-
vated through injected bacterial effectors that target host small GTPases and tyrosine kinases. Once inside the host cell, S. flex-
neri escapes from the endocytic vacuole within minutes to move intra- and intercellularly. We quantified the fluorescence signals
from fluorescently tagged host factors that are recruited to the site of pathogen entry and vacuolar escape. Quantitative time
lapse fluorescence imaging revealed simultaneous recruitment of polymerizing actin, small GTPases of the Rho family, and ty-
rosine kinases. In contrast, we found that actin surrounding the vacuole containing bacteria dispersed first from the disassem-
bling membranes, whereas other host factors remained colocalized with the membrane remnants. Furthermore, we found that
the disassembly of the membrane remnants took place rapidly, within minutes after bacterial release into the cytoplasm. Super-
resolution visualization of galectin 3 through photoactivated localization microscopy characterized these remnants as small,
specular, patchy structures between 30 and 300 nm in diameter. Using our experimental setup to track the time course of infec-
tion, we identified the S. flexneri effector IpgB1 as an accelerator of the infection pace, specifically targeting the entry step, but
not vacuolar progression or escape. Together, our studies show that bacterial entry into host cells follows precise kinetics and
that this time course can be targeted by the pathogen.
I
nvasive pathogens such as Shigella flexneri, Salmonella enterica,
or Listeria monocytogenes are capable of subverting host factors
to induce their uptake into typically nonphagocytic epithelial
and/or endothelial cells (32). This is achieved via bacterial constit-
uents or adhesive molecules present on the pathogen surface, the
secretion of soluble bacterial factors, or the translocation of effec-
tors into the host cell through specialized molecular injection de-
vices. Independent of the mode of interaction, the internalization
process is rapid for all studied pathogens, requiring only a few
minutes and featuring a complex and coordinated interplay be-
tween host and bacterial factors.
After ingestion of spoiled food or water, as few as 10 to 100
bacteria are sufficient to cause an infection resulting in mucosal
ulceration and bloody diarrhea, qualifying Shigella as a potent
enteroinvasive pathogen (20). Upon contact of S. flexneri with an
epithelial cell, the injection of effectors through the type III secre-
tion system (T3SS) leads to the formation of a signaling platform
consisting of the bacterial translocon complex constituents IpaB
and IpaC and the targeting of host factors through injected effec-
tors (25, 37). Together, these induce a complex rearrangement of
the cortical cytoskeletal components, resulting in the formation of
lamelipodia that engulf the pathogen and lead to its uptake. These
events are coordinated by bacterial effectors, e.g., IpgB1 and
IpgB2, IpgD, or IpaC, and host factors, mainly the small GTPases
of the Rho family, Rac, Cdc42, and kinases, such as Abl and Src (4,
7, 38). Apart from GTPases and kinases, other signaling molecules
have been implicated in the entry process of S. flexneri, namely,
inositol signaling, which is targeted by IpgD (7).
Examplarily, the bacterial effector IpgB1 mimics RhoG at the
host plasma membrane and interferes with the ELMO/Dock180
pathway (12, 27). Furthermore, the homologous effector IpgB2,
together with IpgB1, orchestrates bacterial entry through their
GEF activities, which have been reported for both of them in vitro
(11, 18). The activation of the GTPases induces members of the
WASP family verprolin-homologous protein family (WAVE) that
in turn activate the actin-nucleating Arp2-Arp3 complex. Addi-
tionally, it has been suggested that the C terminus of IpaC is in-
volved in the activation of the kinase Src (24). In turn, Src and
another tyrosine kinase, Abl, play a role in the bacterial entry
process via the phosphorylation of CrkII at the plasma membrane,
which leads to the recruitment of phosphorylated cortactin to the
S. flexneri entry site (3, 5).
Upon internalization, S. flexneri is surrounded by an endocytic
vacuole that is subsequently ruptured, thereby releasing the
pathogen into the host cellular cytoplasm (6, 35). We have re-
cently shown that the rupture happens within minutes after up-
take and can be spotted using fluorescently labeled galectin 3 as a
marker for the disassembled membranes (30, 34). It is believed
that the membrane remnants are then processed into smaller ves-
Received 29 December 2011 Returned for modification 22 January 2012
Accepted 12 April 2012
Published ahead of print 23 April 2012
Editor: J. B. Bliska
Address correspondence to Jost Enninga, jostenn@pasteur.fr.
Supplemental material for this article may be found at http://iai.asm.org/.
Copyright © 2012, American Society for Microbiology. All Rights Reserved.
doi:10.1128/IAI.06391-11
2548
iai.asm.org
Infection and Immunity
p. 2548–2557
July 2012
Volume 80
Number 7

----!@#$NewPage!@#$----
icles, and it has been shown that they are targeted to the autophagy
machinery by the tethering of autophagy markers to the site of
ruptured membranes, which in turn leads to the induction of sig-
naling pathways (8). Further, it has been found that autophagy-
associated signaling is also triggered from S. flexneri surrounded
by septin structures termed septin cages (22, 23).
The dynamic recruitment of host factors to the forming vacu-
ole and to the membrane remnants upon vacuolar disruption is
still poorly understood. So far, only a few studies have tracked
bacterial entry into living host cells in real time compared to in-
vestigations that used endpoint assays (2, 24, 29, 34). Therefore,
we aimed at obtaining a more precise picture of the temporal
events surrounding the entry of S. flexneri. HeLa cells were trans-
fected with a set of host factors, and the time course of their teth-
ering to the site of bacterial entry and the disassembly of the en-
docytic vacuole was monitored. This allowed us to delineate the
functional hierarchies of host factor recruitment during the entry
process, which involves different families of signaling molecules,
namely, kinases or GTPases. We observed the simultaneous re-
cruitment of the small GTPases Rac, RhoA, and Cdc42 and of the
kinases Src and Abl to the site of bacterial entry, which contrasted
with a specific sequence of events for their dispersal during the
process of vacuolar rupture. Further, we show that the vacuolar
membranes disassemble rapidly upon release of the pathogen into
the cytoplasm. Finally, we revealed that the bacterial effector
IpgB1 is responsible for the rapid entry of bacteria into the host
and propose that it acts as a pacemaker of infection.
MATERIALS AND METHODS
Cell culture and infection assays. All cell culture reagents were purchased
from Invitrogen unless otherwise stated. Human epithelial HeLa cells
were cultured in Dulbecco’s modified Eagle’s medium (DMEM) supple-
mented with 10% (vol/vol) fetal bovine serum (FBS), 50 �g/ml penicillin,
50 �g/ml streptomycin, and 2 mM L-glutamine at 37°C, 5% CO2. All
live-cell fluorescence microscopy was performed in EM buffer (120 mM
NaCl, 7 mM KCl, 1.8 mM CaCl2, 0.8 mM MgCl2, 5 mM glucose, 25 mM
HEPES, pH 7.3).
Overnight bacterial cultures were inoculated at a 1/100 dilution in
tryptic casein soy broth (TCSB) with the appropriate antibiotic if required
and grown to an optical density at 600 nm (OD600) of �0.3. Before infec-
tion, the bacteria were washed with PBS and coated with poly-L-lysine
(Sigma Corp.) at a final concentration of 10 �g/ml to facilitate bacterial
adhesion to cells. After 10 min of incubation at room temperature, the
bacteria were washed 2 times with PBS, resuspended in the medium of the
cells that were prepared for infection, and used immediately.
Bacterial strains. The following S. flexneri strains were used: S. flexneri
M90T (wild type), S. flexneri M90T expressing dsRed, BS176 (no viru-
lence plasmid), an ipgB1 strain (nonpolar mutant of the effector IpgB1),
and the complemented ipgB1/pHA61 strain (these strains were described
previously [11, 36, 19]). All bacterial strains were grown in TCSB at 37°C.
The growth medium was supplemented with kanamycin (100 �g/ml) or
ampicillin (50 �g/ml), depending on the resistance of the strain used.
Plasmids and transfection. For the expression of actin-mOrange, the
mOrange coding sequence was inserted into the actin-EGFP-C3 plasmid
by excising the enhanced green fluorescent protein (EGFP) sequence at
the NheI/XhoI sites and inserting the mOrange sequence (the primers
used were as follows: 5=, AGAGCTGCTAGCATGGTGAGCAAGGGCGA
GGA, and 3=, AGAGTCCTCGAGATCTGAGTCCGGACTTCTACAGCT
CGTCCATGC). The construct was verified by sequencing. For the expres-
sion of galectin 3-tandem Eos fluorescent protein (tdEos), the tdEos
coding sequence was inserted in the peGFP-N1 plasmid (BD Biosciences
Clontech) by excising the EGFP at the BamHI/NotI sites and inserting the
tdEos sequence (the primers used were as follows: 5=, AGCTGGATCCAT
CCACCGGTCGCCACCATG, and 3=, AGTCGCGGCCGCTCTAGAGT
CGCGGCCGCTTA) and by inserting the galectin 3 coding sequence at
the KpnI/BamHI sites (the primers used were as follows: 5=, ATGCGGT
ACCCGCCACCATGGCAGACAATTTTTCGCTC, and 3=, GCATGGAT
CCGTATCATGGTATATGAAGCACT). The construct was verified by
sequencing. The other plasmids have been described previously, as fol-
lows: pEGFP-galectin 3 (30), pEGFP-actin (24), pOrange-galectin 3 (34),
pOrange-RhoA (34), pEYFP-RhoA (17), pEYFP-Rac1 (17), pOrange-
Rac1 (34), pEGFP-Abl (5), and pEGFP-Src (24).
For transfection of samples that were processed for indirect immuno-
fluorescence, HeLa cells were plated on 12-well plates containing glass
coverslips at a density of 2 � 104 cells per coverslip (diameter, 12 mm;
thickness, 0.13 to 0.17 mm) 24 h before transfection. For transfection of
samples that were processed for live-cell imaging, HeLa cells were seeded
into glass bottom dishes 35 mm in diameter at a density of 2 � 105 cells per
dish (Mattek) or 96-well glass bottom plates (Nunc) at a density of 3 � 104
cells per plate 24 h before transfection.
Microscopy and image analysis. Bacterial invasion was measured in
real time on a Leica DM or Nikon inverted microscope equipped with a
heated stage, using a 40� N-Plan Objective for simultaneous phase-con-
trast imaging (Leica or Nikon), and fluorescence imaging was performed
with excitation at 465 to 500 nm (fluorescein isothiocyanate [FITC]) and
532 to 554 nm (rhodamine), and emission was detected with 516- to
556-nm (FITC) and 573- to 613-nm (rhodamine) filters. Images were
captured using a Cascade 512B camera or a CoolSnap2 camera (Roeper
Scientific). Images were acquired in the two fluorescent channels and in
trans every 30 s or 90 s. Time lapse series were analyzed with the freeware
program ImageJ (http://rsb.info.nih.gov/ij/) and further processed using
Excel (Microsoft).
Superresolution imaging. Glass coverslips (diameter, 18 mm; thick-
ness, 1) were cleaned using acetone (high-grade pure) treatment for 1 h,
followed by overnight treatment with a potassium hydroxide solution at
0.1 M and extensive cleaning with autoclaved ultrapure water.
HeLa cells were maintained in DMEM F-12 medium (without phenol
red) supplemented with 4% FBS and 1% penicillin/streptomycin. Forty-
eight hours before bacterial infection, HeLa cells were seeded on the
treated coverslips and transfected with 1.5 �g of the plasmid galectin
3-tdEos. For the infection assay, S. flexneri M90T bacterial cultures were
prepared as previously described. Galectin 3-tdEos-transfected cells were
incubated for 45 min with S. flexneri M90T at a multiplicity of infection of
100. Afterward, samples were fixed with 2% paraformaldehyde for 30 min
at 37°C, washed, and incubated with 0.5 �l of fluorescent beads (2 mM
0.1-�m TetraSpeck microspheres, fluorescent blue/green/orange/dark
red; Invitrogen) for 30 min. For imaging, coverslips were mounted in PBS.
Photoactivated localization microscopy (PALM) imaging was per-
formed on a home-made setup, previously described in detail (1, 15),
based on a Nikon Ti-E eclipse microscope system. For tdEos activation
and imaging, the system uses a solid-state laser with an emission wave-
length at 488 nm (Spectra Physics, Japan) and diode lasers with emission
wavelengths at 405 nm and 561 nm (Spectra Physics, Japan). Observations
were performed with a 100� oil immersion objective (numerical aperture
[NA], 1.49) and detected by an electron-multiplying charge-coupled de-
vice (EM-CCD) camera (Ixon DV887ECS-BV; Andor, Belfast, Northern
Ireland). Imaging was performed with a final magnification of �150,
corresponding to a pixel size of 107 nm. Sequences of 50,000 to 100,000
wide-field fluorescence images compatible with PALM were acquired
with a 50-ms exposure time. During acquisition of PALM image se-
quences, the 561-nm laser power was kept constant for readout of the
tdEos activated state, and the 405-nm laser was pulsed at decreasing fre-
quencies adjusted manually to maintain a stable number of active fluoro-
phores per frame. The imaging parameters were set using the �Manager
freeware (http://www.micro-manager.org/), and laser control was
achieved with custom software (15).
After acquisition, each sequence of raw diffraction-limited images was
processed with ImageJ and QuickPALM (15). The QuickPALM software
Host Factor Dynamics during Shigella Entry
July 2012
Volume 80
Number 7
iai.asm.org
2549

----!@#$NewPage!@#$----
computed the positions of individual molecules and reconstructed super-
resolution images with an initial arbitrary pixel size of 10 nm by superim-
posing Gaussian spots with a full-width-Hald-maximum (FWHM) of 30
nm centered on these positions. The imaged fluorescent beads were used
as fiducial markers for drift correction. To estimate the average resolution,
23 small clusters of galectin 3-tdEos were aligned by their center of mass,
and the FWHM of the superimposed clusters was calculated, yielding an
estimated resolution of 28 nm.
RESULTS
Numerous studies have described the recruitment of the host ac-
tin cytoskeleton, regulatory factors like small GTPases of the Rho
family, and tyrosine kinases to the entry site of enteroinvasive
bacteria, such as Shigella or Salmonella (9, 31). The studies discov-
ered a growing family of host proteins involved in the entry pro-
cess. We aimed at studying the spatiotemporal hierarchies be-
tween some representative host protein family members at the
bacterial entry site throughout the successive steps of internaliza-
tion during cell challenge with S. flexneri wild type and the ipgB1
mutant strain.
Host proteins involved in cytoskeletal rearrangements are
recruited simultaneously to the S. flexneri entry site. Figure 1A
(for more detail, see Movie S1 in the supplemental material) dis-
plays a series of time lapse images of actin-GFP-transfected HeLa
cells challenged with dsRed-expressing S. flexneri. These images
confirm the well-documented massive actin rearrangements upon
host cellular contact with the bacterium. We used such image
series to establish a quantification procedure with the open-source
software ImageJ to determine the time points when the accumu-
lation of a host factor became detectable at the site of bacterial
entry and when it reached its maximum at the entry site before the
disassembly of the individual entry focus. These quantifications
were performed in order to decipher the order of host factor re-
cruitment at the bacterial entry site. As a control, we compared the
bacterial entry kinetics in transfected cells with those of nontrans-
fected cells and found no significant differences. We then went on
to challenge HeLa cells with S. flexneri cotransfected with fluores-
cently tagged actin and members of the small GTPase family. Fig-
ure 1B (for more detail, see Movie S2 in the supplemental mate-
FIG 1 Sequential recruitment and dispersal of host molecules involved in the
entry of S. flexneri into epithelial cells. (A) HeLa cells transfected with actin-
EGFP were challenged with S. flexneri expressing dsRed and monitored by time
lapse fluorescence microscopy. The recruitment of actin to the entry site high-
lights the successive internalization steps, bacterial contact, focus formation,
collapse of the entry focus, and intracytoplasmic bacteria moving along actin
tails. (B) Simultaneous tracking of host cellular actin and the small GTPase
RhoA at the entry site shows that they are both recruited to the bacterial entry
site at the same time. (C) Simultaneous tracking of the host cellular kinase Abl
and the GTPase RhoA at the entry site shows that they are both recruited at the
same time. Abl is tethered to the apical edges of the forming foci, whereas
RhoA spreads diffusely through the focus and is enriched around the vacuole
containing bacteria. Representative data from 5 to 10 independent experi-
ments are shown.
FIG 2 Quantification of the sequence of recruitment of bulk actin, small
GTPases, and kinases to the entry site of S. flexneri. The images were quantified
by thresholding from the image sequences displayed in Fig. 1 (see Materials
and Methods for details). Actin, small GTPases, and kinases are rapidly re-
cruited to the pathogen entry site (between 200 and 400 s after contact), and
these factors reach their peak at the entry foci between 425 and 725 s after
bacterial contact. The standard deviations (SD) (error bars) indicate high vari-
ance of the events temporally, making it impossible to delineate clear hierar-
chies of recruitment. 1, delay of host factor recruitment to the pathogen entry
site upon bacterial contact; 2, time window between host factor recruitment
and the time point with the peak of the individual foci before their disassembly.
Data from 5 to 10 independent experiments are shown.
Ehsani et al.
2550
iai.asm.org
Infection and Immunity

----!@#$NewPage!@#$----
rial) shows that actin and RhoA are simultaneously recruited at
the entry site upon challenge. Similar results were obtained with
other small GTPases, such as Rac1 or Cdc42 (data not shown).
Tyrosine kinase recruitment was exemplarily studied using Abl
(Fig. 1C; for more detail, see Movie S3 in the supplemental mate-
rial) and Src (24) (see Fig. S1 in the supplemental material) fused
to EGFP. Cotransfection of Abl and RhoA showed that both were
recruited to the bacterial entry site at the same time points; how-
ever, their localizations differed upon recruitment. Abl was lo-
cated at the distal tips of the forming membrane ruffles, whereas
the GTPases, such as RhoA, were spread throughout the entry
focus or around the entering bacterium, as was previously shown
for Src (24, 25). This was expected, since distinct functions during
the entry process have previously been attributed to the different
recruited host factors (25, 28).
Next, we quantified the fluorescence intensities at the S. flex-
neri entry sites, setting stringent thresholds in the ImageJ software.
The time point of the start of host factor recruitment was deter-
mined as the time point when fluorescence values were at least
50% above the background levels before bacterial contact. Then,
we determined the time span between this time point and the time
point of bacterial contact that could be identified in the TRANS
channel (1 in Fig. 2). Second, we measured the mean fluorescence
intensity in the area of bacterial entry and determined the time
point when it reached its maximum. We then subtracted the time
point of bacterial contact from the time point when a maximum
mean fluorescence intensity was present within the entry focus.
This was used to determine the time it took to reach maximal host
factor recruitment, coordinating the cytoskeletal rearrangements
at the entry site (2 in Fig. 2). Figure 2 depicts the summary of these
quantifications for the recruitment of actin, Rac1, RhoA, and Src.
Strikingly, we found that all these factors are recruited simultane-
ously at the bacterial entry site upon bacterial contact, and the
large standard deviations show pronounced variability at the sin-
gle-cell level (Fig. 2, columns numbered 1). Further, recruitment
of the analyzed host factors appeared rapidly upon contact, within
200 to 400 s. Similar results were obtained when analyzing the
time it took to reach maximal recruitment of host factors to the
entry foci. Here, we found again that the maxima were reached
within similar time intervals for all measured host factors and that
the standard deviations were pronounced for all analyzed scenar-
ios, highlighting large variability in the kinetics of the entry pro-
cess. We also realized that there is some variability in the dimin-
ishing of the recruited host factor signals at the entry site, e.g., the
massive early actin recruitment disappeared before the RhoA sig-
FIG 3 Rapid assembly and disassembly of galectin 3 around the ruptured membranes after vacuolar escape of S. flexneri. (A) Galectin 3 flags the membrane
remnants upon vacuolar rupture of the pathogen. The remnants (indicated by the arrow) are typically present only for a few minutes upon membrane rupture
and cannot be distinguished from background signal (arrowheads) at later time points. (B) In some instances, galectin 3 remains associated with the membrane
remnants (arrows) for hours after escape from the vacuole. Representative data from at least 10 independent experiments are shown.
Host Factor Dynamics during Shigella Entry
July 2012
Volume 80
Number 7
iai.asm.org
2551

----!@#$NewPage!@#$----
nal in Fig. 1B. However, we have not been able to establish a
reliable algorithm to quantify this phenomenon.
Disassembly of the ruptured vacuolar membrane remnants
is highly dynamic. We went on to investigate the subsequent step
of S. flexneri invasion, bacterial escape from the endocytic vacuole.
In particular, we were interested in tracking the fate of the disas-
sembling membranes that constituted the endocytic vacuole con-
taining bacteria using the recently described marker galectin 3
(30). It has been shown that fluorescently tagged galectin 3 is re-
cruited to the bacterial entry site within seconds after vacuolar
rupture and that it targets the disassembling membranes sur-
rounding the bacterium (30, 34). By cotransfecting HeLa cells
with actin-EGFP and galectin 3-mOrange, we confirmed this
rapid recruitment of galectin 3 to the entering bacteria, which
highlights the ruptured membranes as “bacterial ghost-like”
structures (Fig. 3A and B, top; see Movie S1 in the supplemental
material for more details). Strikingly, our time lapse experiments
demonstrated that the galectin 3 vacuolar-membrane-wrapping
signal was very short-lived, disappearing within 5 to 15 min after
bacterial escape from the vacuole (Fig. 3A, arrow). At later time
points, the galectin 3 signal was similar to background signals in
cells that were not invaded by S. flexneri (compare the specific
signal, indicated by an arrow, and the nonspecific background
signals, indicated by arrowheads, in Fig. 3A). In a few cases, galec-
tin 3 highlighted the bacterial ghost-like structures for more than
30 min without disassembling into smaller membrane vesicles.
However, it turned out to be difficult to quantify the extent of this
phenomenon, due to the heterogeneity of the measured signal
(Fig. 3B, arrows in the bottom row). Together, these findings show
the rapid processing of the disassembling membranes at the bac-
terial entry site that are subsequently targeted to autophagy (8).
To analyze the membrane disassembly in more detail, we per-
formed PALM, which achieves a 10-fold increase in resolution
over the classical optical limit in microscopy (roughly 30 nm ver-
sus 300 nm) (1, 16). PALM imaging of the photoactivatable tdEos
fused to galectin 3 was used to obtain superresolution insight into
the cellular localization of the protein upon the rupture of the
vacuole containing bacteria.
HeLa cells were transfected with galectin 3-tdEos and infected
with S. flexneri M90T. We selected seven different individual fixed
cells featuring visible galectin 3 staining accumulating around the
ruptured membranes of the invading bacteria and superresolved
them through PALM imaging. Two representative samples are
shown in Fig. 4A to D (first example) and E to H (second exam-
ple). PALM allowed us to discern small patchy accumulations of
galectin 3 in the vicinity of the bacteria (Fig. 4C and G). Impor-
tantly, no structures with a lumen (resembling vesicles) could be
observed. Further analyses of the cluster sizes of these small accu-
mulations of galectin 3 permitted us to observe a distribution of
sizes ranging from 30 nm (the estimated resolution of PALM im-
ages) to 300 nm in diameter (see Fig. S2 in the supplemental ma-
terial). These structures are beyond the resolution limit of stan-
dard wide-field epifluorescence microscopy and thus cannot be
accurately discerned by standard imaging methods (Fig. 4B and
F). Larger clusters of galectin 3 with diameters between 100 and
200 nm are found predominantly in the vicinity of the disassem-
bling bacterial vacuole, but not in the rest of the host cellular
cytoplasm (see Fig. S2 in the supplemental material), indicating
the vacuolar degradation surrounding the bacteria.
We then investigated the localization of the simultaneously
recruited host factors (Fig. 1 and 2) at the site of the vacuole con-
taining bacteria around the time of vacuolar escape. In contrast to
their recruitment to the entry site, we found that the disassembly
process showed a higher level of organization with regard to the
temporal sequence of events. We found that the accumulated ac-
tin surrounding the bacteria within vacuoles diminished before
the recruitment of galectin 3 (Fig. 5A and C; for more detail, see
Movie S5 in the supplemental material). Interestingly, the galectin
FIG 4 High-resolution analysis of disassembling vacuoles by superresolution microscopy. (A to H) HeLa cells transfected with galectin 3-tdEos fluorescent
protein (tdEosFP) were infected with S. flexneri M90T. PALM shows galectin 3-tdEos being organized in heterogeneous patchy clusters in the bacterial
enveloping vacuoles. The images correspond to two different acquisitions representative of a total of 7 cells from 2 independent experiments. (A and E) Merges
of the bright-field (gray), wide-field epifluorescence (green), and superresolution PALM (red) images. (B to D and F to H) Zoomed images of the bacterial region.
(B and F) Wide-field epifluorescence. (C and G) PALM imaging. (D and H) Merges of wide-field epifluorescence and PALM imaging. Scale bars: A and E, 1,000
nm; B to D and F to H, 500 nm.
Ehsani et al.
2552
iai.asm.org
Infection and Immunity

----!@#$NewPage!@#$----
3 (arrowheads) and actin (arrows) signals around the disassem-
bling vacuoles were mutually exclusive. Furthermore, actin could
not be readily identified around smaller vesicular structures po-
tentially derived from disassembling vacuoles at later time points
after the escape of S. flexneri to the cytoplasm. In contrast, the
small GTPase Rac1 was also recruited to the vacuole containing
bacteria; however, it remained located around the membrane
remnants upon vacuolar rupture, colocalizing with galectin 3 (Fig.
5B and D; for more detail, see Movie S6 in the supplemental ma-
terial). The tyrosine kinase Src (24) (see Fig. S1 in the supplemen-
tal material) is also recruited to the Shigella-containing vacuole,
but this event was not seen with the kinase Abl and the small
GTPase RhoA, which were both recruited rather diffusely or at the
distal ends of the forming entry foci (Fig. 1). Together, these find-
ings show that, despite simultaneous recruitment of the investi-
gated host factors to the entering bacteria, the sequence of events
during vacuolar disassembly appear to be temporally well orga-
nized.
IpgB1 accelerates the pace of invasion by S. flexneri. It has
been reported that the S. flexneri T3SS effector IpgB1 mimics small
GTPases to promote their entry into epithelial host cells (11, 12,
27). Using low multiplicities of infection (MOIs) (between 1 and
5) and following bacterial internalization at successive time points
by gentamicin protection assay, we found that the ipgB1 strain
showed reduced entry. However, increasing the load of challeng-
ing bacteria or increasing the time periods of infection impeded
the readout of this endpoint assay (data not shown). Therefore, we
chose to track the dynamics of the time course of internalization
and the recruitment of host factors to the bacterial entry site using
the ipgB1 mutant with the aim of measuring the effects on the
entry kinetics. Performing time lapse microscopy on HeLa cells
transfected with the host factors shown in Fig. 1 and 2, we found
that the ipgB1 mutant was able to enter host cells; however, the
time periods of host factor recruitment to the bacterial contact site
and entry were massively reduced (Fig. 6A and C; see Fig. S3 and
Movie S7 in the supplemental material) compared to the wild-
type bacteria (Fig. 6B and C; see Fig. S3 in the supplemental ma-
terial). The wild-type phenotype was restored when the ipgB1
complemented strain was used (see Fig. S3 in the supplemental
material).
We also tested whether IpgB1 affected the subsequent step of
vacuolar maturation and escape of the bacteria into the cytoplasm.
To do this, we performed time lapse microscopy on HeLa cells
coexpressing fluorescent actin and galectin 3, challenged with ei-
ther the wild-type, ipgB1, or complemented strain (Fig. 7). Again,
we found that the entry of the ipgB1 strain was delayed (Fig. 7A;
FIG 5 Hierarchies of host factor dispersal from the disassembling vacuoles. (A) HeLa cells were cotransfected with galectin 3-mOrange (arrow, red) and
actin-EGFP (arrowhead, green) before being challenged with S. flexneri. Time lapse microscopy shows that actin disperses from the vacuole containing bacteria
before its disassembly. Staining of the two factors is mutually exclusive. (B) Enlargement of an image from panel A. The arrowhead shows the actin signal (green)
surrounding one moiety of a bacterium, and the arrow shows the other moiety with galectin 3 accumulation (red). (C) HeLa cells were cotransfected with galectin
3-mOrange (arrow, red) and Rac1-EGFP (arrowhead, green) before being challenged with S. flexneri. Rac1 surrounds the entering bacteria and remains
associated with the galectin 3-positive membrane remnants after vacuolar rupture. (D) Enlargement of an image from panel C. The arrowhead and arrow point
to the overlapping signal (orange) of Rac and galectin 3. Representative data from 7 independent experiments are shown.
Host Factor Dynamics during Shigella Entry
July 2012
Volume 80
Number 7
iai.asm.org
2553

----!@#$NewPage!@#$----
see Movie S8 in the supplemental material). Interestingly, we
identified some actin accumulation around the bacteria in contact
with the host plasma membrane (Fig. 7A, middle; for more detail
see Fig. S4 in the supplemental material), hinting at the involve-
ment of multiple pathways for actin cytoskeletal rearrangement.
Quantifying the time course of vacuolar escape, we were not able
to measure significant differences between the ipgB1, the wild-
type, and the complemented strains (Fig. 7B). In conclusion, the
data presented in Fig. 6 and 7 suggest that IpgB1 represents a
bacterial T3SS effector that accelerates the pace of S. flexneri entry
into host cells as a means to boost bacterial infectivity but that it
does not impact the subsequent steps.
DISCUSSION
Using time lapse microscopy, we demonstrated the simultaneous
recruitment of host small GTPases and kinases to the site of S.
flexneri entry into epithelial cells. Even though it is evident that
bacterial invasion has to be highly organized, the functional hier-
archies between the involved host factors have not been identified
with precision (2, 7). So far, hierarchies of small GTPases have
been described only in the case of Salmonella infection (28, 29).
Simultaneous host factor recruitment (Fig. 1 and 2) may call
into question the importance of strict hierarchies during cellular
invasion or may highlight the fact that the entry process is follow-
ing not only one pathway, but multiple pathways, as previously
proposed for S. enterica (13, 14). However, it also highlights the
limitations of the performance of our microscopes with regard to
both spatial and temporal resolution. Another fact that has to be
considered is the activation of the signaling molecules involved;
for example, GTPases can switch between GDP- and GTP-bound
states, and kinases can be activated via phosphorylation. Such ac-
tivities have already been taken into account by some studies on
host-pathogen interactions, for example, in the case of Yersinia,
using functionalized fluorescence resonance energy transfer
(FRET) probes for the GTP state of small GTPases (39). Neverthe-
less, these studies require a high level of experimental sophistica-
tion, impeding its broad use throughout the scientific community.
Considering the manifold and seemingly contradictory functions
of the injected bacterial effectors on the host, such as actin poly-
merization via IpaC and its depolymerization via IpaA, we suggest
that future studies will be required to reveal the precise recruit-
ment of host factors and their dispersal (24). This will be facili-
tated once the precise enzymatic functions of the injected effectors
have been revealed.
It is possible to track the step of vacuolar escape of S. flexneri
with more precision. Recently, we have shown that this event takes
place rapidly upon internalization (26, 34). Vacuolar escape has
also been found for other cytoplasmic bacteria, for example, Lis-
teria and Rickettsia (35). Strikingly, in this study, we show the
rapid disassembly of the membrane remnants (Fig. 3) that have
been reported to be coated with autophagy markers upon vacuo-
lar rupture (8). This shows that the signaling events leading to the
“digestion” of the membrane remnants have to be very rapid,
efficient, and transient. PALM microscopy revealed the heteroge-
neous, patchy nature of the membrane remnants (Fig. 4). First, we
found that the disassembled membranes were not hollow, high-
lighting their multilayered or micellar organization. Second, their
resolvable size distribution spanned 30 to 300 nm (see Fig. S1 in
the supplemental material). Based on these observations, we sug-
gest that the membrane remnants are eventually disassembled or
recycled, not only by a single mechanism, but by multiple mech-
FIG 6 The S. flexneri ipgB1 strain enters HeLa cells, but at a reduced rate. (A) Time lapse microscopy of cells cotransfected with actin and Rac1 and challenged
with the S. flexneri wild-type strain. Arrows show bacterial entry sites. (B) Cells transfected similarly to those in panel A and challenged with an S. flexneri ipgB1
mutant. Arrows show bacterial entry sites. (C) Quantification of the entry dynamics of the S. flexneri wild-type (WT) and ipgB1 strains was performed using the
time-lapse image series. Data from 5 independent experiments are shown. The error bars indicate SD.
Ehsani et al.
2554
iai.asm.org
Infection and Immunity

----!@#$NewPage!@#$----
anisms. Further, it is likely that the heterogeneous vesicular rem-
nants result in the induction of multiple signaling pathways.
Taking advantage of our single-cell-based assays, we also found
that some bacteria remained vacuole bound in vesicles coated with
actin. It would be interesting to investigate the fate of these vacu-
ole-bound bacteria, for example, if they are also targeted to the
autophagy pathway. So far, it has been reported that cytoplasmic
bacterial pathogens can be trapped within septin cages that send
specific signals to trigger autophagy (22, 23). In addition to these
signaling events, we suggest that future studies investigate whether
septins can also be recruited to S. flexneri trapped within actin-
coated vacuoles and whether the signals emanating from the
trapped vacuolar bacteria are different from the signals emanating
from cytoplasmic bacteria trapped in septin cages.
Where S. flexneri succeeded in escaping from the endocytic
vacuoles, we noted that the dispersal of the host factors surround-
ing the cytoplasmic escaping bacteria appeared to be more orga-
nized than the recruitment during the initial steps of entry (Fig. 5).
Since the membrane remnants appear to be targeted to the au-
tophagy machinery, it will be important to investigate whether the
sequential recruitment and dispersal of host factors around these
remnants impacts the signaling cascades emanating from them.
Challenging host cells with a number of bacterial mutants, for
example, with the translocon component IpaB or IpaC, results in
very little or no invasion of the host cells (10). In contrast, mutant
strains for other effectors show attenuated and subtle invasion
phenotypes. One of these is the GEF IpgB1 that interferes with the
ELMO/Dock180 pathway at the host plasma membrane upstream
of the small GTPases (12, 27). An S. flexneri mutant strain for
IpgB1 and IpgB2 was as invasive as the wild-type strain, indicating
FIG 7 Effects of Shigella IpgB1 on entry and vacuolar disassembly. (A) Time lapse microscopy of HeLa cells cotransfected with actin-EGFP and galectin
3-mOrange challenged with the wild-type strain, with the ipgB1strain, or with the ipgB1 strain complemented with IpgB1. The ipgB1 mutant escaped efficiently
from the endocytic vacuole. (B) Quantification of the time intervals between entry focus formation and escape of S. flexneri wild-type, S. flexneri ipgB1, and
complemented strains from vacuoles. The wild-type bacteria escaped from the vacuoles at the same rate as the ipgB1 mutant. Representative data from 4
independent experiments are shown. The error bars indicate SD.
Host Factor Dynamics during Shigella Entry
July 2012
Volume 80
Number 7
iai.asm.org
2555

----!@#$NewPage!@#$----
that these homologous effectors have contradictory functions
(11). In this work, we show that IpgB1 increases the pace of bac-
terial invasion, and we propose that the attenuated invasion phe-
notype of the ipgB1 strain is caused by an alteration of the overall
invasion time course (Fig. 6). This identified a bacterial T3SS ef-
fector as a pacemaker for infection targeting one precise step of the
entry process. Strikingly, subsequent steps, such as the delay be-
tween entry and vacuolar escape, were not affected in the ipgB1
mutant strain (Fig. 7). Often, loss-of-function studies of pathogen
invasion, either using mutants or performing gene silencing via
small interfering RNAs, result in phenotypes with a somewhat
reduced but far from complete loss of infectivity (21). This can be
a result of cellular plasticity or redundancy of host factor function.
For example, this has been shown for S. enterica, which enters host
cells via a pathway including the Arp2-Arp3 complex or via a
myosin II-dependent pathway (13, 14). Nevertheless, pathway
plasticity/redundancy is only one explanation of attenuated phe-
notypes. Consequently, we suggest that future studies should fo-
cus on the implication of merely kinetic effects of invasion, and we
propose that time lapse investigations are perfectly suited for such
studies. We are convinced that such kinetic studies will shift our
idea of the functions of numerous bacterial effectors and involved
host factors during the dynamic interplay between pathogens and
their hosts.
Our results indicate the rapidity of events around the entering
pathogens and also highlight the fact that perturbation of the sys-
tem results in altered time courses of the invasion process. Micros-
copy-based high-throughput screens have become widely popular
to investigate host-pathogen interactions in single cells (33). For
the most part, they are performed as endpoint assays yielding only
a single time point of the investigated events. Screens performed
by different research groups investigating the same phenomenon
have yielded different, even opposing, results (33). One possible
explanation lies in the limitations of the assays used for the studies.
Having described galectin 3 as a marker for vacuolar rupture, our
work underlines the fact that it is particularly suited for time lapse
investigation (30). On the other hand, the rapid disassembly of the
membrane remnants upon rupture hampers efficient signal detec-
tion at later time points of infection (Fig. 3). Therefore, care must
be taken in choosing the appropriate time points when using ga-
lectin 3 in endpoint assays in fixed samples.
ACKNOWLEDGMENTS
We thank C. Parsot, R. Tsien, J. Swanson, and A. M. Pendergast for pro-
viding us with plasmids and/or bacterial strains. We are particularly
thankful to M. Lelek for support in the PALM experiments. We acknowl-
edge the members of the PFID at the Institut Pasteur for excellent micros-
copy support.
S.E. was supported by a grant from the Fondation Schlumberger pour
l’Education et la Recherche. J.C.S. and C.D.R. were the recipients of
fellowships from the Portuguese Fundaça�o para a Ciência e Tecnologia,
FCT (SFRH/BD/51006/2010 and SFRH/BPD/41004/2007, respectively).
C.D.R. is presently a Marie Curie fellow.
REFERENCES
1. Betzig E, et al. 2006. Imaging intracellular fluorescent proteins at nano-
meter resolution. Science 313:1642–1645.
2. Bobard A, Mellouk N, Enninga J. 2011. Spotting the right location—
imaging approaches to resolve the intracellular localization of invasive
pathogens. Biochim. Biophys. Acta 1810:297–307.
3. Bougneres L. Girardin SE, et al. 2004. Cortactin and Crk cooperate to
trigger actin polymerization during Shigella invasion of epithelial cells. J.
Cell Biol. 166:225–235.
4. Bourdet-Sicard R, et al. 1999. Binding of the Shigella protein IpaA to
vinculin induces F-actin depolymerization. EMBO J. 18:5853–5862.
5. Burton EA, Plattner R, Pendergast AM. 2003. Abl tyrosine kinases are
required for infection by Shigella flexneri. EMBO J. 22:5471–5479.
6. Clerc P, Sansonetti PJ. 1987. Entry of Shigella flexneri into HeLa cells:
evidence for directed phagocytosis involving actin polymerization and
myosin accumulation. Infect. Immun. 55:2681–2688.
7. Dunn JD, Valdivia RH. 2010. Uncivil engineers: Chlamydia, Salmonella
and Shigella alter cytoskeleton architecture to invade epithelial cells. Fu-
ture Microbiol. 5:1219–1232.
8. Dupont N, et al. 2009. Shigella phagocytic vacuolar membrane remnants
participate in the cellular response to pathogen invasion and are regulated
by autophagy. Cell Host Microbe 6:137–149.
9. Ehsani S, Rodrigues CD, Enninga J. 2009. Turning on the spotlight—
using light to monitor and characterize bacterial effector secretion and
translocation. Curr. Opin. Microbiol. 12:24–30.
10. Enninga J, Mounier J, Sansonetti P, Tran Van Nhieu G. 2005. Secretion
of type III effectors into host cells in real time. Nat. Methods 2:959–965.
11. Hachani A, et al. 2008. IpgB1 and IpgB2, two homologous effectors
secreted via the Mxi-Spa type III secretion apparatus, cooperate to medi-
ate polarized cell invasion and inflammatory potential of Shigella flexenri.
Microbes Infect. 10:260–268.
12. Handa Y, et al. 2007. Shigella IpgB1 promotes bacterial entry through the
ELMO-Dock180 machinery. Nat. Cell Biol. 9:121–128.
13. Hanisch J, et al. 2010. Molecular dissection of Salmonella-induced mem-
brane ruffling versus invasion. Cell Microbiol. 12:84–98.
14. Hanisch J, et al. 2011. Activation of a RhoA/myosin II-dependent but
Arp2/3 complex-independent pathway facilitates Salmonella invasion.
Cell Host Microbe 9:273–285.
15. Henriques R, et al. 2010. QuickPALM: 3D real-time photoactivation
nanoscopy image processing in ImageJ. Nat. Methods 7:339–340.
16. Hess ST, Girirajan TP, Mason MD. 2006. Ultra-high resolution imaging
by fluorescence photoactivation localization microscopy. Biophys. J. 91:
4258–4272.
17. Hoppe AD, Swanson JA. 2004. Cdc42, Rac1, and Rac2 display distinct
patterns of activation during phagocytosis. Mol. Biol. Cell 15:3509–3519.
18. Huang Z, et al. 2009. Structural insights into host GTPase isoform selec-
tion by a family of bacterial GEF mimics. Nat. Struct. Mol. Biol. 16:853–
860.
19. Konradt C, et al. 2011. The Shigella flexneri type three secretion system
effector IpgD inhibits T cell migration by manipulating host phosphoino-
sitide metabolism. Cell Host Microbe 9:263–272.
20. Kotloff KL, et al. 1999. Global burden of Shigella infections: implications
for vaccine development and implementation of control strategies. Bull.
World Health Organ. 77:651–666.
21. Misselwitz B, et al. 2011. RNAi screen of Salmonella invasion shows role
of COPI in membrane targeting of cholesterol and Cdc42. Mol. Syst. Biol.
7:474.
22. Mostowy S, et al. 2010. Entrapment of intracytosolic bacteria by septin
cage-like structures. Cell Host Microbe 8:433–444.
23. Mostowy S, et al. 2011. p62 and NDP52 proteins target intracytosolic
Shigella and Listeria to different autophagy pathways. J. Biol. Chem. 286:
26987–26995.
24. Mounier J, et al. 2009. The IpaC carboxyterminal effector domain medi-
ates Src-dependent actin polymerization during Shigella invasion of epi-
thelial cells. PLoS Pathog. 5:e1000271. doi:10.1371/journal.ppat.1000271.
25. Nhieu GT, Enninga J, Sansonetti P, Grompone G. 2005. Tyrosine kinase
signaling and type III effectors orchestrating Shigella invasion. Curr.
Opin. Microbiol. 8:16–20.
26. Nothelfer K, Dias Rodrigues C, Bobard A, Phalipon A, Enninga J. 2011.
Monitoring Shigella flexneri vacuolar escape by flow cytometry. Virulence
2:54–57.
27. Ohya K, Handa Y, Ogawa M, Suzuki M, Sasakawa C. 2005. IpgB1 is a
novel Shigella effector protein involved in bacterial invasion of host cells.
Its activity to promote membrane ruffling via Rac1 and Cdc42 activation.
J. Biol. Chem. 280:24022–24034.
28. Patel JC, Galan JE. 2006. Differential activation and function of Rho GTPases
during Salmonella-host cell interactions. J. Cell Biol. 175:453–463.
29. Patel JC, Galan JE. 2008. Investigating the function of Rho family
GTPases during Salmonella/host cell interactions. Methods Enzymol.
439:145–158.
Ehsani et al.
2556
iai.asm.org
Infection and Immunity

----!@#$NewPage!@#$----
30. Paz I, et al. 2010. Galectin-3, a marker for vacuole lysis by invasive
pathogens. Cell Microbiol. 12:530–544.
31. Perrett CA, Jepson MA. 2007. Applications of cell imaging in Salmonella
research. Methods Mol. Biol. 394:235–273.
32. Pizarro-Cerda J, Cossart P. 2006. Bacterial adhesion and entry into host
cells. Cell 124:715–727.
33. Prudencio M, Lehmann MJ. 2009. Illuminating the host—how RNAi screens
shed light on host-pathogen interactions. Biotechnol. J. 4:826–837.
34. Ray K, et al. 2010. Tracking the dynamic interplay between bacterial and
host factors during pathogen-induced vacuole rupture in real time. Cell
Microbiol. 12:545–556.
35. Ray K, Marteyn B, Sansonetti PJ, Tang CM. 2009. Life on the inside: the
intracellular lifestyle of cytosolic bacteria. Nat. Rev. Microbiol. 7:333–340.
36. Sansonetti PJ, Ryter A, Clerc P, Maurelli AT, Mounier J. 1986. Multi-
plication of Shigella flexneri within HeLa cells: lysis of the phagocytic
vacuole and plasmid-mediated contact hemolysis. Infect. Immun. 51:
461–469.
37. Schroeder GN, Hilbi H. 2008. Molecular pathogenesis of Shigella spp.:
controlling host cell signaling, invasion, and death by type III secretion.
Clin. Microbiol. Rev. 21:134–156.
38. Terry CM, et al. 2008. The C-terminus of IpaC is required for effector
activities related to Shigella invasion of host cells. Microb. Pathog. 45:282–
289.
39. Wong KW, Mohammadi S, Isberg RR. 2006. Disruption of RhoGDI and
RhoA regulation by a Rac1 specificity switch mutant. J. Biol. Chem. 281:
40379–40388.
Host Factor Dynamics during Shigella Entry
July 2012
Volume 80
Number 7
iai.asm.org
2557