Article
Mitochondria mediate septin cage assembly to
promote autophagy of Shigella
Andrea Sirianni1, Sina Krokowski1, Damián Lobato-Márquez1, Stephen Buranyi1, Julia Pfanzelter2,
Dieter Galea1, Alexandra Willis1, Siân Culley3, Ricardo Henriques3, Gerald Larrouy-Maumus4,
Michael Hollinshead5, Vanessa Sancho-Shimizu6,7, Michael Way2,6 & Serge Mostowy1,*
Abstract
Septins, cytoskeletal proteins with well-characterised roles in cyto-
kinesis, form cage-like structures around cytosolic Shigella flexneri and
promote their targeting to autophagosomes. However, the processes
underlying septin cage assembly, and whether they influence
S. flexneri proliferation, remain to be established. Using single-cell
analysis, we show that the septin cages inhibit S. flexneri proliferation.
To study mechanisms of septin cage assembly, we used proteomics
and found mitochondrial proteins associate with septins in S. flexneri-
infected cells. Strikingly, mitochondria associated with S. flexneri
promote septin assembly into cages that entrap bacteria for auto-
phagy. We demonstrate that the cytosolic GTPase dynamin-related
protein 1 (Drp1) interacts with septins to enhance mitochondrial fis-
sion. To avoid autophagy, actin-polymerising Shigella fragment mito-
chondria to escape from septin caging. Our results demonstrate a role
for mitochondria in anti-Shigella autophagy and uncover a fundamen-
tal link between septin assembly and mitochondria.
Keywords autophagy; cytoskeleton; mitochondria; septin; Shigella
Subject Categories Autophagy & Cell Death; Microbiology, Virology & Host
Pathogen Interaction
DOI 10.15252/embr.201541832 | Received 26 November 2015 | Revised 21 April
2016 | Accepted 4 May 2016 | Published online 3 June 2016
EMBO Reports (2016) 17: 1029–1043
See also: ET Spiliotis & L Dolat (July 2016)
Introduction
Autophagy was initially characterised as a mechanism for recycling
cellular contents in response to nutrient limitation [1]. In recent
years, however, it has also been recognised as an important defence
mechanism against intracellular bacteria [2,3]. Bacterial autophagy,
similar to autophagy of mitochondria [4], involves ubiquitin-binding
adaptor proteins such as p62 or NPD52 interacting with LC3 family
proteins for autophagosome formation [5]. Relatively little is known
about the roles of the cytoskeleton in autophagy [6,7]. Work has
shown that actin-dependent processes regulate autophagy of cyto-
solic bacteria [6]. In the case of Listeria monocytogenes, it is to avoid
autophagy recognition, whereas for Shigella flexneri it is to attract
autophagy [8,9].
Septins are highly conserved GTP-binding proteins that associate
with cellular membranes and actin filaments [10]. By acting as
protein scaffolds and diffusion barriers for subcellular compartmen-
talisation, septins have key roles in numerous cellular processes
including
cytokinesis
and
host–pathogen
interactions
[10,11].
During S. flexneri infection, septins entrap actin-polymerising bacte-
ria in cage-like structures to restrict their motility and dissemination
[12,13]. In contrast, during L. monocytogenes infection, the effector
ActA masks bacteria from septin cage assembly [8,12,13]. Bacterial
septin cages are not an artefact of cells in culture as they have also
have been observed in vivo using zebrafish (Danio rerio), highlight-
ing the importance of septins as an evolutionarily conserved deter-
minant of host defence [14].
The processes underlying septin cage assembly are not fully
understood. In the current study, we uncover a link between mito-
chondria and the assembly of septin cages around S. flexneri. These
findings show that mitochondria promote septin cage assembly for
antibacterial autophagy, and Shigella fragment mitochondria to
counteract septin cage entrapment.
Results
SEPT7 is required for Shigella–septin cage formation
Septin subunits are classified into four different homology groups,
namely the SEPT2, SEPT3, SEPT6 and SEPT7 groups (Table EV1).
1 Section of Microbiology, MRC Centre for Molecular Bacteriology and Infection, Imperial College London, London, UK
2 Cellular Signalling and Cytoskeletal Function Laboratory, The Francis Crick Institute, Lincoln’s Inn Fields Laboratory, London, UK
3 Quantitative Imaging and NanoBiophysics Group, MRC Laboratory for Molecular Cell Biology, Department of Cell and Developmental Biology, University College London,
London, UK
4 Faculty of Natural Sciences, Department of Life Sciences, MRC Centre for Molecular Bacteriology and Infection, Imperial College London, London, UK
5 Department of Pathology, University of Cambridge, Cambridge, UK
6 Section of Virology, St. Mary’s Medical School, Imperial College London, London, UK
7 Section of Paediatrics, St. Mary’s Medical School, Imperial College London, London, UK
*Corresponding author. Tel: + 44 20 7594 3072; Fax: + 44 20 7594 3095; E-mail: s.mostowy@imperial.ac.uk
ª 2016 The Authors. Published under the terms of the CC BY 4.0 license
EMBO reports
Vol 17 | No 7 | 2016
1029
Published online: June 3, 2016 

----!@#$NewPage!@#$----
Septins from different groups form hetero-oligomeric complexes that
assemble into non-polar filaments that form higher-order structures,
such as rings [15–17]. SEPT7 is a ubiquitously expressed septin, and
an obligate subunit of heteromeric septin filaments [15]. However,
the role of SEPT7 during bacterial infection remains to be estab-
lished. We infected the human epithelial cell line HeLa using
S. flexneri and observed that SEPT7 was recruited to 15.7 � 2.1%
of intracellular Shigella at 4 h 40 min postinfection as cage-like
structures (Fig EV1A), consistent with the recruitment of SEPT2,
SEPT6, SEPT9 and SEPT11 [12,13]. Structured illumination micro-
scopy (SIM) showed that SEPT7 assembled into 3.2 � 0.7 lm
(length) × 1.2 � 0.1 lm (width) cages around S. flexneri (Fig EV1B
and Movie EV1). These dimensions are similar to values previously
obtained for SEPT2 cages using stochastic optical reconstruction
microscopy (STORM) [12]. To investigate the role of SEPT7 in
Shigella–septin cage formation, we used small interfering RNAs
(siRNAs). We then infected SEPT7-depleted cells with Shigella and
quantified septin cage formation (Fig EV1C). We observed a signifi-
cant reduction in SEPT2 (5.0 � 1.6 fold), SEPT7 (5.7 � 0.6 fold)
and SEPT9 (5.0 � 1.0 fold) cages in SEPT7-depleted cells, highlight-
ing an essential role for SEPT7 in Shigella–septin cage formation.
SEPT7 cages restrict bacterial replication
Septin cages around cytosolic S. flexneri promote their targeting to
autophagosomes [12,13]. However, it remains to be established
whether septin cages also influence bacterial proliferation. To
explore this possibility, we investigated whether bacteria entrapped
by SEPT7 cages are metabolically active. We focused on SEPT7
because it is essential for Shigella–septin caging (Fig EV1A–E). To
allow single bacterial analysis, we engineered inducible fluorescent
(x-light) S. flexneri strains based on isopropyl b-D-1-thiogalacto-
pyranoside (IPTG)-inducible plasmids (Fig 1A). HeLa cells were
infected with x-light Shigella for 4 h 10 min, then IPTG was added for
30 min prior to fixation, and the percentage of intracellular bacteria
that could respond to IPTG, and thus metabolically active, was quan-
tified. We found that only 45.5 � 1.7% of bacteria entrapped in
SEPT7
cages were metabolically active (Fig 1B). In
contrast,
91.4 � 0.8% of intracellular bacteria not entrapped in septin cages
were metabolically active (Fig 1B). Consistent with results showing
that septin cages target bacteria to autophagy [12,13], similar values
were obtained for bacteria recruiting p62 (46.7 � 2.5%) compared
to p62-negative bacteria (88.3 � 1.1%) (Fig 1C).
Approximately 58–45% of bacteria entrapped in SEPT7 cages
were metabolically active at different time points tested (Fig EV1F).
To examine whether metabolically inactive bacteria were dead or in
the process of dying, we treated bacteria with SYTOX, a marker for
compromised cellular membrane characteristic of dead cells. We
found that 98.7 � 0.4% of bacteria that failed to respond to IPTG
were also positive for SYTOX (Fig 1D). To investigate whether
septin cages are recruited to dead cytosolic bacteria, we treated
infected cells with erythromycin. In the presence of erythromycin,
there is a significant reduction in SEPT7 cages (Fig 1E). These
results clearly showed that septin cages recognise live bacteria to
restrict their proliferation.
Mitochondrial proteins associate with the Shigella–septin cage
Given their importance in restricting bacterial proliferation, we set
out to identify host determinants involved in Shigella–septin cage
formation using a tandem affinity purification approach (Fig 2A).
HeLa cells expressing a STREP–FLAG-tagged SEPT6 were infected
with Shigella for 4 h 40 min. Subsequently, sequential STREP and
FLAG pulldowns were performed on the infected cell lysates, and
bound proteins identified using mass spectrometry. Using this
approach, we identified 56 proteins associated with septins in
Shigella-infected cells (Dataset EV1). Among the identified proteins,
31
also
associate
with
septins
in
non-infected
control
cells
(Dataset EV2), including SEPT2, SEPT6, SEPT7, SEPT9 and SEPT11,
highlighting the ability of septins to form hetero-oligomeric protein
complexes [10,11]. In contrast, the hallmark autophagy proteins
p62 and LC3B were only isolated from Shigella-infected cells
(Dataset EV1). The interaction between SEPT6 and p62 during
Shigella infection was confirmed by co-immunoprecipitation in
HeLa cells stably expressing SEPT6-GFP (Fig 2B). Gene ontology
(GO) analysis reveals that 21.4% of proteins bound to septins in
Shigella-infected cells are classified as exclusively mitochondrial
(Figs 2C and EV2). Considering this, we set out to investigate the
interplay between septin assembly and mitochondria.
Mitochondria promote Shigella–septin cage assembly
We asked whether septin rings assemble on the mitochondrial
membrane by treating uninfected cells with cytochalasin D, to
induce septin assembly [18]. Mitochondria were indeed localised to
71.4 � 1.7% of septin rings (Figs 3A and EV3A), suggesting that
▸
Figure 1.
SEPT7 cages inhibit bacterial replication.
A
Model depicting the x-light system used for single bacterial analysis. Shigella flexneri M90T carry an inducible plasmid (x-light Shigella) engineered with the LacI
repressor system from Escherichia coli, and a GFP or mCherry gene downstream of the operator. In the presence of IPTG, metabolically active bacteria stop LacI
repressor activity. As a consequence, the fluorescent protein is synthesised when bacteria are metabolically active.
B
HeLa cells were infected with x-light Shigella-mCherry for 4 h 40 min for quantitative confocal microscopy. IPTG was added 30 min prior to fixation, and then
samples were labelled with antibody for SEPT7. The scale bar represents 5 lm. Graph represents mean % � SEM of Shigella responding to IPTG outside (�) or inside
(+) SEPT7 cages from four independent experiments. Student’s t-test, ***P < 0.001.
C
HeLa cells were infected with x-light Shigella-mCherry for 4 h 40 min for quantitative confocal microscopy. IPTG was added 30 min prior to fixation, and then
samples were labelled with antibody for p62. The scale bar represents 5 lm. Graph represents mean % � SEM of Shigella responding to IPTG without (�) or with (+)
p62 from at least four independent experiments. Student’s t-test, ***P < 0.001.
D
Control (CTRL) or isopropanol-treated x-light Shigella-GFP were induced with IPTG for 30 min and then labelled with SYTOX Orange for 10 min. The scale bar
represents 5 lm.
E
HeLa cells were infected for 2 h 10 min, treated with ethanol (CTRL) or erythromycin (EM) for 2 h prior to fixation and then labelled with antibody for SEPT7. Graph
represents mean % � SEM of Shigella in SEPT7 cages from three independent experiments. Student’s t-test, ***P < 0.001.
EMBO reports
Vol 17 | No 7 | 2016
ª 2016 The Authors
EMBO reports
Mitochondria promote septin cages
Andrea Sirianni et al
1030
Published online: June 3, 2016 

----!@#$NewPage!@#$----
septins use mitochondrial membrane to promote their assembly into
rings. Using MitoTracker, we also observed a close association of
mitochondria with septin cages surrounding Shigella, there being
80 � 1.4% of septin cages associated with mitochondria in infected
cells (Fig 3B). The close association of mitochondria with septin
cages entrapping bacterium was further highlighted by correlative
A
B
C
D
E
Figure 1.
ª 2016 The Authors
EMBO reports
Vol 17 | No 7 | 2016
Andrea Sirianni et al
Mitochondria promote septin cages
EMBO reports
1031
Published online: June 3, 2016 

----!@#$NewPage!@#$----
light electron microscopy (CLEM), showing that mitochondrial
membrane can be distinct from the septin-compartmentalised
autophagosome surrounding Shigella (Figs 3C and EV3B). In agree-
ment with this, live cell imaging reveals that mitochondria support
the sites of septin ring assembly around bacterium (Fig 3D and
Movie EV2).
To
test
whether
septin–mitochondria
interactions
promote
septin cage assembly, we infected dynamin-related protein 1
(Drp1)-depleted cells with Shigella. In the absence of Drp1, where
mitochondria are elongated and more available as a source of
membrane for autophagy [19,20], the number of septin cages is
significantly increased (1.4 � 0.0 fold; Fig 3E). To counteract the
availability of mitochondrial membrane, we infected Mitofusin1
(Mfn1)-depleted cells with Shigella. In the absence of Mfn1, a
protein required for mitochondrial fusion [21,22], mitochondria are
less available as a source of membrane for autophagy [19,20].
Concomitant with this, the number of septin cages is significantly
reduced (2.6 � 0.1 fold; Figs 3E and EV3C). Together, these
A
C
B
Figure 2.
Proteins enriched at the Shigella–septin cage.
A
Schematic representation of the proteomic experiments used to isolate proteins enriched at the Shigella–septin cage. (a) A SEPT6–STREP–FLAG construct was (b)
transfected in HeLa cells for 24 h. (c) Cells were infected with Shigella flexneri AfaI for 4 h, harvested, and (d) SEPT6–STREP–FLAG cage-associated proteins were
isolated through co-immunoprecipitation (Co-IP).
B
HeLa cells stably expressing SEPT6-GFP were infected with S. flexneri AfaI for 4 h, harvested and then tested with Co-IP. Empty vector and/or uninfected HeLa cells
were used in parallel as control. GFP-trap magnetic agarose beads were used to isolate SEPT6-GFP from cells, and extracts were immunoblotted for SEPT6, GFP,
SEPT7 or p62. The lysates were immunoblotted for GAPDH as control for cellular protein levels.
C
The protein pulldown experiments identified 56 proteins putatively associated with the Shigella–septin cage and then categorised into six groups based on the
analysis from the Gene Ontology database. See also Dataset EV1.
EMBO reports
Vol 17 | No 7 | 2016
ª 2016 The Authors
EMBO reports
Mitochondria promote septin cages
Andrea Sirianni et al
1032
Published online: June 3, 2016 

----!@#$NewPage!@#$----
A
C
D
E
B
Figure 3.
ª 2016 The Authors
EMBO reports
Vol 17 | No 7 | 2016
Andrea Sirianni et al
Mitochondria promote septin cages
EMBO reports
1033
Published online: June 3, 2016 

----!@#$NewPage!@#$----
findings demonstrate that mitochondria promote septin assembly
into the cages that entrap Shigella for antibacterial autophagy.
A role for septins in mitochondrial fission
Recent work has shown that actin and non-muscle myosin II enable
Drp1-mediated mitochondrial fission, in a process called mitokinesis
[23–28]. Septins regulate actomyosin formation/constriction during
cytokinesis [29]. Consistent with this, mitochondrial fission defects
have been observed in the absence of septins in vivo in mice [30].
Examining the localisation of SEPT6-GFP in uninfected HeLa cells, we
observed that septin filaments localise to the sites of mitochondrial fis-
sion (Fig 4A). EM and immunolabelling for SEPT7 further highlighted
septin filaments intersecting with the sites of mitochondrial fission
(Figs 4B and EV4). To visualise septin–mitochondria interactions
using live cell imaging, we performed super-resolution microscopy on
SEPT6-GFP cells labelled with MitoTracker (Fig 4C and Movie EV3).
Strikingly, live cell imaging revealed that septins induce mitochon-
drial constriction and enable mitochondrial division. Together, obser-
vations using fixed and live cell microscopy suggest that septins
coordinate the timing and position of mitochondrial fission.
Drp1 localises with SEPT7 at the sites of mitochondrial constric-
tion/fission
(Fig 4D).
To
investigate
the
relationship between
septins and Drp1, we targeted SEPT7 to mitochondria using an ActA
construct that targets to mitochondria [31]. In cells expressing ActA-
SEPT7-mRFP, mitochondria colocalising with septins fragment and
recruit significantly more Drp1 than mitochondria in control cells
(Fig 4E). These findings further support a role for septins in Drp1-
mediated mitochondrial fission.
Drp1 interacts with septins to enhance mitochondrial fission
To test how septins are involved in mitochondrial fission, we anal-
ysed the length of mitochondria in septin-depleted cells (Figs 5A
and B, and EV5). In the absence of SEPT7, mitochondria are signifi-
cantly
longer
than
in
control
cells
(6.4 � 0.6 lm
versus
3.5 � 0.2 lm). A similar increase in mitochondria length is also
observed
in
the
absence
of
SEPT2
(5.1 � 0.1 lm),
SEPT9
(5.9 � 0.1 lm) or Drp1 (6.2 � 0.3 lm) (Figs 5A and B, and EV5).
The simultaneous loss of SEPT7 and Drp1 did not lead to further
increases in mitochondria length as compared to single depletion
experiments (Fig 5B). This suggests that SEPT7 and Drp1 are acting
in the same pathway during mitochondrial fission. In agreement
with this, an interaction between GFP-tagged SEPT6 and Drp1 was
confirmed by co-immunoprecipitation (Fig 5C).
Phosphorylation of serine 616 of Drp1 is required for mitochon-
drial fission [32,33]. The depletion of SEPT7 did not affect levels of
Drp1 or Drp1 S616 phosphorylation (Fig 5D). However, the recruit-
ment of phosphorylated Drp1 to mitochondria is significantly
decreased as compared to control cells (Fig 5E). In agreement with
elongated mitochondria, levels of Mfn1 are significantly increased in
the absence of SEPT7 (1.7 � 0.1 fold; Fig 5D). Furthermore, the
intensity of Mfn1 labelling along mitochondria is significantly
increased as compared to control cells (Fig 5F). Together, these data
demonstrate that septins facilitate recruitment of Drp1 to the mito-
chondrial membrane and enable fission.
Shigella fragment mitochondria to counteract septin
cage entrapment
Given that septins localise to the sites of mitochondrial fission, we
tested the role of mitochondrial fission in septin caging of Shigella.
We performed live cell imaging in Mfn1-depleted cells, where mito-
chondria are fragmented, and did not observe septin cage formation.
In contrast, live cell imaging in Drp1-depleted cells reveals that non-
fragmented, tubular mitochondria support septin cage assembly
(Fig 6A
and
Movie EV4).
Moreover,
33.4 � 1.7%
of
Shigella
entrapped in SEPT7 cages are metabolically active in Drp1-depleted
cells (Fig 6B). Together, these findings show that the non-fragmented
mitochondria promote septin cage assembly and its action against
entrapped bacterium.
A role for mitochondria in Shigella proliferation has not been
shown, though previous work demonstrates that Shigella invasion
fragments mitochondria [34–36]. We reasoned that Shigella induce
mitochondrial fragmentation to counteract septin cage entrapment.
Consistent with this, we observed that mitochondria surrounding
septin cages entrapping Shigella are 2.2 � 0.1 fold longer than mito-
chondria surrounding intracellular Shigella lacking septin cages
(Fig 6C). Furthermore, we did not observe septin cage assembly
in cells where mitochondria are fragmented by the expression of
ActA-SEPT7-mRFP. We found that local mitochondrial fragmen-
tation induced by Shigella is dependent on IcsA (Fig 6D), the
Shigella effector used to polymerise actin. Actin has a key role in
Drp1-mediated mitochondrial fission [23–28], and these findings
◀
Figure 3.
Mitochondria promote septin cage assembly.
A
HeLa cells were labelled with MitoTracker Red CMXRos, treated with cytochalasin D for 30 min, then fixed and labelled for endogenous SEPT7 for confocal
microscopy. The scale bar represents 0.5 lm. See also Fig EV3A.
B
HeLa cells were infected with Shigella flexneri for 4 h 40 min, labelled with MitoTracker Red CMXRos, fixed and labelled with antibody for endogenous SEPT7 for
quantitative confocal microscopy. The scale bar represents 1 lm.
C
HeLa cells stably expressing SEPT6-GFP were transfected with Mito-BFP for 24 h, infected with Shigella-mCherry for 4 h 40 min and processed for CLEM. SEPT6 is
shown in green, mitochondria in red and Shigella-mCherry in blue. Septin cages identified by fluorescent light microscopy (FLM) were processed for TEM. The right-
most image is enlarged from the boxed region in the TEM image and shows the bacterium (Sf) surrounded by a double membrane of autophagy (Au) and the
mitochondrial membrane (Mt). The scale bar represents 1 lm. See also Fig EV3B.
D
HeLa cells stably expressing SEPT6-GFP were transfected with Mito-BFP for 24 h and then infected with Shigella-mCherry for 2 h for live confocal microscopy. Time
frame sequence shows a septin cage assembling around Shigella. Mitochondria (circle) support the sites of septin ring assembly around the bacterium. Each frame
was acquired every 2 min. The scale bar represents 1 lm. See also Movie EV2.
E
HeLa cells were treated with control (CTRL), Drp1 or Mfn1 siRNA for 72 h. Whole-cell lysates were immunoblotted for Drp1 or Mfn1 to show the efficiency of
depletion. GAPDH was used as a loading control. siRNA-treated cells were infected with S. flexneri for 4 h 40 min, then fixed for microscopy and stained for
endogenous SEPT7 for quantitative confocal microscopy. Graph represents the mean % � SEM of Shigella inside SEPT7 cages from at least four independent
experiments per treatment. Student’s t-test, **P < 0.01; ***P < 0.001.
EMBO reports
Vol 17 | No 7 | 2016
ª 2016 The Authors
EMBO reports
Mitochondria promote septin cages
Andrea Sirianni et al
1034
Published online: June 3, 2016 

----!@#$NewPage!@#$----
A
C
D
E
B
Figure 4.
ª 2016 The Authors
EMBO reports
Vol 17 | No 7 | 2016
Andrea Sirianni et al
Mitochondria promote septin cages
EMBO reports
1035
Published online: June 3, 2016 

----!@#$NewPage!@#$----
show that the actin-polymerising Shigella fragment mitochondria as
a mechanism to counteract septin cage entrapment (Fig 6E).
Discussion
Septins form cage-like structures around cytosolic S. flexneri to
prevent actin tail formation and dissemination [12,13]. However, the
processes underlying septin cage assembly, and whether septin cages
influence bacterial proliferation, were unknown. Here, we demon-
strate that septin cages assemble to restrict S. flexneri proliferation.
We show that mitochondria promote septin assembly into the cages
that entrap Shigella for autophagy, and Shigella employ mitochon-
drial fragmentation to avoid septin cage entrapment. Our results
reveal a close relationship between septin assembly and mitochon-
dria and highlight a new role for mitochondria in host defence.
Depending on the fragmentation of mitochondria by IcsA, cyto-
solic Shigella are compartmentalised in septin cages or form actin
tails for cell-to-cell spread (Fig 6E). In the case of Listeria, no efficient
septin caging has been observed [12,13]. Listeria has been reported
to fragment mitochondria by expressing listeriolysin O (LLO, a pore
forming toxin encoded by the gene hly), and hly mutants fail to frag-
ment mitochondria [37]. Given that Shigella–septin cage assembly is
both actin dependent and mitochondria-connected, we speculate that
Listeria, via its expression of LLO, also uses mitochondrial fragmen-
tation to counteract septin cage assembly. Mitochondrial fragmenta-
tion may be a general strategy by pathogens to avoid cell-
autonomous immunity. In-depth investigation of infection by other
cytosolic bacteria that polymerise actin, including Mycobacterium
marinum and Rickettsia spp., will help to precisely describe the coor-
dination between septin assembly and mitochondria.
The study of actin-based motility is one of the best examples
highlighting how research into a bacterial-induced process can yield
insight into basic cellular processes [38]. By studying the mecha-
nism of septin cage assembly around Shigella, we have discovered
new links between mitochondria and septin assembly. Mitochon-
drial dynamics by fission and fusion are crucial for cellular homeo-
stasis [39]. A key player in mitochondrial fission is Drp1, which is
recruited to the outer mitochondrial membrane, oligomerises at the
fission site and hydrolyses GTP for membrane ingression. Work has
recently shown that actin and non-muscle myosin II enable Drp1-
mediated fission in a process called mitokinesis [23–28]. In this
case, actomyosin activity can provide the force for mitochondrial
membrane pre-constriction prior to Drp1 secondary constriction. In
agreement with this, our findings show that septins play an impor-
tant role in Drp1-mediated mitochondrial fission. Given that septins
◀
Figure 4.
A role for septins in mitochondrial fission.
A
HeLa cells expressing SEPT6-GFP were stained with MitoTracker Red CMXRos and fixed for confocal microscopy. Inset image highlights the location of septins at the
sites of mitochondrial fission. The scale bar represents 5 lm.
B
HeLa cells were fixed and labelled with antibody against SEPT7 and secondary antibody coupled to HRP, and processed for TEM. The right image is enlarged from the
boxed region in the TEM image and shows a SEPT7 (S7) filament (labelled in black) intersecting with the mitochondrial (Mt) fission site. The scale bar represents
100 nm. See also Fig EV4.
C
HeLa cells were stained with MitoTracker Red CMXRos for live SOFI-based super-resolution microscopy. Each image was reconstructed from 100 raw TIRF frames
using a custom-made SOFI-based algorithm. Arrows highlight SEPT6 association with the location of mitochondrial fission. The scale bar represents 1 lm. See also
Movie EV4.
D
HeLa cells were labelled with MitoTracker Red CMXRos, fixed for widefield microscopy and labelled with antibodies to SEPT7 and Drp1. Arrows highlight one example
of Drp1 and SEPT7 association with the location of mitochondrial fission. The scale bar represents 1 lm.
E
HeLa cells were transfected with Mito-BFP and ActA-SEPT7 mCherry, fixed and labelled with antibody to Drp1 for widefield microscopy. The scale bar represents
5 lm. Inset images highlight Drp1 and SEPT7 associated with the sites of mitochondrial fission. Pearson’s correlation coefficient from three independent experiments
(mean � SEM) shows that the mitochondria in ActA-SEPT7-transfected cells recruit significantly more Drp1 than control cells (Mito-BFP transfected alone). Student’s
t-test, *P < 0.05.
▸
Figure 5.
Drp1 interacts with septins to enhance mitochondrial fission.
A
HeLa cells were treated with control (CTRL), SEPT7 or Drp1 siRNA for 72 h. Whole-cell lysate of siRNA-treated cells were immunoblotted for GAPDH, SEPT7 or Drp1 to
show the efficiency of siRNA depletion. GAPDH was used as a loading control. siRNA-treated cells were labelled with MitoTracker Red CMXRos and fixed for confocal
microscopy. The scale bar represents 5 lm.
B
HeLa cells were treated with control (CTRL), SEPT2, SEPT7, SEPT9, Drp1 or SEPT7 + Drp1 siRNA for 72 h, labelled with MitoTracker Red CMXRos and fixed for
quantitative confocal microscopy. Graph represents the length (lm; whiskers from min to max) of mitochondria in siRNA-treated cells from three independent
experiments (analysis of at least 100 measurements per biological replicate). Student’s t-test, ***P < 0.001.
C
HeLa cells stably expressing SEPT6-GFP were harvested and then tested with Co-IP. HeLa cells expressing GFP were used in parallel as control. GFP-trap magnetic
agarose beads were used to isolate SEPT6-GFP from cells, and extracts were immunoblotted for Drp1, SEPT2, SEPT7 or GFP. The lysates were immunoblotted for
GAPDH as control for cellular protein levels.
D
HeLa cells were treated with control (CTRL) or SEPT7 siRNA for 72 h, and whole-cell lysates were immunoblotted for SEPT7, Drp1, phosphorylated Drp1 (P-Drp1) or
Mfn1. GAPDH was used as a loading control. Graph represents the mean % � SEM of the relative amount of Drp1, P-Drp1, Mfn1 or SEPT7 proteins quantified by
densitometry from 4 independent experiments. Student’s t-test, ns: non-significant; **P < 0.01, ***P < 0.001.
E
HeLa cells were treated with control (CTRL) or SEPT7 siRNA for 72 h, labelled with MitoTracker Red CMXRos, then fixed and labelled for endogenous P-Drp1 for
quantitative confocal microscopy. Representative images shown here. The scale bar represents 1 lm. The recruitment of P-Drp1 to mitochondria was significantly
decreased as compared to control cells as measured by Pearson’s correlation coefficient from at least five independent experiments (mean � SEM, analysis of at least
250 cells per biological replicate). Student’s t-test, *P < 0.05.
F
HeLa cells were treated with control (CTRL) or SEPT7 siRNA for 72 h, labelled with MitoTracker Red CMXRos, then fixed and labelled for endogenous Mfn1 for
quantitative confocal microscopy. Representative images shown here. The scale bar represents 1 lm. The recruitment of Mfn1 to mitochondria was significantly
increased as compared to control cells as measured by Pearson’s correlation coefficient from at least five independent experiments (mean � SEM, analysis of at least
250 cells per biological replicate). Student’s t-test, *P < 0.05.
EMBO reports
Vol 17 | No 7 | 2016
ª 2016 The Authors
EMBO reports
Mitochondria promote septin cages
Andrea Sirianni et al
1036
Published online: June 3, 2016 

----!@#$NewPage!@#$----
A
B
D
E
F
C
Figure 5.
ª 2016 The Authors
EMBO reports
Vol 17 | No 7 | 2016
Andrea Sirianni et al
Mitochondria promote septin cages
EMBO reports
1037
Published online: June 3, 2016 

----!@#$NewPage!@#$----
regulate actomyosin formation/constriction during cytokinesis [29],
we propose that septins regulate actomyosin to induce mitochon-
drial constriction and enable Drp1 binding for mitochondrial divi-
sion. The endoplasmic reticulum (ER) also makes contact with
mitochondria at mitochondrial constriction sites [40,41]. The mole-
cules that mediate ER–mitochondrial contacts are not fully known;
however, the cytoskeleton is likely to be involved [23]. The role of
septins in this process awaits investigation.
Mitochondria are complex organelles and how they can regulate
the infection process in cellular environments is not fully defined.
However, this knowledge is necessary for a complete understanding
of infectious processes. Previous work has shown that mitochondria
supply membranes to autophagosomes during starvation [42].
Although a possibility exists that mitochondria also supply proteins
or membranes to the septin cage in particular conditions, in this
study we focused our analysis on the role of mitochondria in the
support of septin cage assembly. Our findings show that the mito-
chondria promote septin cage assembly for antibacterial autophagy,
and Shigella fragment mitochondria to counteract septin cage
assembly. Septins may have a key role in both Shigella entrapment
for autophagy and also IcsA-mediated fragmentation of mitochon-
dria (Fig 6E). We speculate that Shigella can fragment mitochondria
via septin and Drp1 recruitment to IcsA-mediated actin polymerisa-
tion. On the other hand, IcsA-mediated fragmentation of mitochon-
dria can be qualitatively and mechanistically different from a fission
mechanism dependent upon septins and Drp1. Future experiments
will be required to address this.
Mitochondrial dynamics and septin assembly appear to be inter-
dependent processes. Septin assembly is membrane facilitated
[43,44], and in vitro assays performed using purified septin fila-
ments have shown they can use phospholipid membranes as a
template for efficient assembly [45]. Septins commonly accumulate
as ring-like structures beneath plasma membrane ingressions, for
example at cleavage furrows, bases of dendritic spines, and phago-
cytic cups [10,11]. However, a source of membrane for cytosolic
septin assembly has not been proposed. Having identified a novel
link between mitochondria and septins, our results reveal mitochon-
dria as required for the efficient assembly of cytosolic septins to
compartmentalise Shigella for autophagy. It is increasingly recog-
nised that interactions between autophagy and the cytoskeleton play
important roles in determining disease outcome [6,46]. It will thus
be of great interest to further study the link between mitochondria,
septin cages and autophagy to identify new therapeutic approaches
for infection control.
Materials and Methods
Bacteria culture
Shigella flexneri M90T [12], M90T AfaI [47], M90T DicsA [12],
M90T-GFP [12], M90T-mCherry [14], M90T-Crimson (kind gift from
Francois-Xavier Campbell) or x-light M90T (GFP or mCherry) [48]
were cultured overnight in trypticase soy (TCS), diluted 50× in fresh
TCS and cultured until OD600 nm = 0.6 as previously described [47].
Cell lines and generation of GFP-SEPT6 stable cell line
HeLa (ATCC CCL-2) or SEPT6-GFP HeLa cells were cultured in
DMEM (GIBCO) and 10% foetal bovine serum (FBS). The pLVX-
GFP-SEPT6 lentiviral expression vector was created by inserting the
human SEPT6_i3 (NP_665798) with a N-terminal GFPtag into the
pLVX-puro vector (Takara Bio Inc.) [49]. Lentivirus was produced
in HEK293FT cells by co-transfection of pLVX-GFP-SEPT6 with
psPAX2 and pMD2.g vectors at a ratio of 10:7:3 lg DNA, respec-
tively
(Trono
laboratory
second-generation
packaging
system;
Addgene). Supernatants from transfected HEK293FT cells containing
the lentivirus were collected 24 and 48 h after transfection, pooled
and filtered. HeLa cells were then infected with lentivirus for 48 h,
and cells stably expressing GFP-SEPT6 were selected by adding
1 lg/ml puromycin to the culturing media.
Plasmids and siRNA oligonucleotides
SEPT6-GFP plasmid [12] was used to make stably expressing HeLa
cell lines. pSA11 and pKB268 plasmids [48] were used to make
x-light S. flexneri M90T strains. ActA-SEPT7-mRFP was donated by
Dr. Elias Spiliotis (Drexel University) and was constructed by ampli-
fying the rat SEPT7 sequence using the primers 50 CAT CTC GAG
ATG TCG GTC AGT GCG 30 and 50 ACT GGA TCC CAA AAG ATC
TTG CCT TTC 30, and cloning it into the XhoI and BamHI sites of
the N1-tagRFP-ActA plasmid, which was a gift from Dr. Adam
▸
Figure 6.
Shigella fragment mitochondria to counteract septin cage assembly.
A
HeLa cells stably expressing SEPT6-GFP were treated with Drp1 siRNA for 72 h, transfected with mito-BFP 24 h and then infected with Shigella flexneri-mCherry for
2 h for live confocal microscopy. Representative image shows interplay between two Shigella–septin cages and fused mitochondria. The scale bar represents 1 lm.
See also Movie EV4.
B
HeLa cells were treated with Drp1 siRNA for 72 h and then infected with x-light Shigella-mCherry for 4 h 40 min for quantitative confocal microscopy. IPTG was
added 30 min prior to fixation, and then samples were labelled with antibody for SEPT7. Graph represents mean % � SEM of Shigella responding to IPTG outside (�)
or inside (+) SEPT7 cages from three independent experiments. Student’s t-test, **P < 0.01.
C
HeLa cells were infected with S. flexneri M90T for 4 h 40 min, labelled with MitoTracker Red CMXRos and fixed for quantitative confocal microscopy. Boxplots show
the length of mitochondria (lm; whiskers from min to max) surrounding Shigella outside (�) or inside (+) SEPT7 cages from three independent experiments (analysis
of at least 130 measurements per biological replicate). Student’s t-test, ***P < 0.001.
D
HeLa cells were either kept uninfected as a control or infected with S. flexneri M90T or S. flexneri DIcsA for 4 h 40 min. Samples were labelled with MitoTracker Red
CMXRos and fixed for quantitative confocal microscopy. Boxplots show length of mitochondria (lm; whiskers from min to max) in uninfected cells (CTRL),
surrounding S. flexneri M90T (+M90T) or S. flexneri DIcsA (+DIcsA) from three independent experiments (analysis of at least 250 measurements per biological
replicate). Student’s t-test, ***P < 0.001.
E
A potential model for the Shigella–septin cage and actin tail assembly pathways. Based on our findings, we propose that (i) mitochondria promote septin cage
assembly for antibacterial autophagy or (ii) Shigella fragment mitochondria to counteract septin cage entrapment. Depending on the fragmentation of mitochondria
by IcsA, Shigella will be compartmentalised in septin cages or spread cell-to-cell via actin-based motility.
EMBO reports
Vol 17 | No 7 | 2016
ª 2016 The Authors
EMBO reports
Mitochondria promote septin cages
Andrea Sirianni et al
1038
Published online: June 3, 2016 

----!@#$NewPage!@#$----
A
B
E
C
D
Figure 6.
ª 2016 The Authors
EMBO reports
Vol 17 | No 7 | 2016
Andrea Sirianni et al
Mitochondria promote septin cages
EMBO reports
1039
Published online: June 3, 2016 

----!@#$NewPage!@#$----
Kwiatkowsi (University of Pittsburgh School of Medicine). ActA-
SEPT7-mRFP and mito-BFP (Addgene #49151) were used for quanti-
tative and real-time confocal microscopy.
Control siRNA (Cat#AM4635) and predesigned siRNA for SEPT2
(ID#14709), SEPT7 (ID#s2743, #s2741), SEPT9 (ID#18228), Drp1
(ID#s19559) or Mfn1 (ID#s31218) were all from Ambion.
The following primers were used for qRT–PCR analysis [50]:
GAPDH qFWD: AATCCCATCACCATCTTCCA
GAPDH qREV: TGGACTCCACGACGTACTCA
SEPT2 qFWD: CACCGAAAATCAGTGAAAAAAGG
SEPT2 qREV: GCTGTTTATGAGAGTCGATTTTCCT
SEPT6 qFWD: GCCAGGGCTTCTGCTTCA
SEPT6 qREV: AGGGTGGACTTGCCCAAAC
SEPT7 qFWD: TGTTGTTTATACTTCATTGCTCCTTCA
SEPT7 qREV: CTTTTTCATGCAAACGCTTCAT
SEPT9 qFWD: CCATCGAGATCAAGTCCATCAC
SEPT9 qREV: CGATATTGAGGAGAAAGGCGTCCGG
Transfection, molecular probes, pharmacological inhibition
HeLa cells (0.8–2 × 105) were plated in 6-well plates (Thermo Scien-
tific) and transfected the following day. siRNA transfection was
performed in DMEM with Oligofectamine (Invitrogen) according to
the manufacturer’s instructions. Cells were tested 72 h after siRNA
transfection.
Plasmid transfections were performed in DMEM with JetPEI
(Polyplus transfection) according to the protocol from [47]. Cells
were tested 24 h after transfection.
Where mentioned, cells were treated with 100 nM MitoTracker
Red CMXRos (Invitrogen) for 20–30 min prior to fixation. For live/
dead stain, cells were treated with 0.4 lM SYTOX Orange nucleic
acid stain (Invitrogen) in the dark for 10 min at room temperature.
For experiments involving pharmacological inhibitors, HeLa cells
were infected and treated for 30 min prior to fixation with 0.05%
DMSO or cytochalasin D (1 lM). Drugs were suspended in DMSO
and handled as suggested by the manufacturer (Sigma). Erythro-
mycin was dissolved in EtOH (25 lg/ml) and used for 2 h prior to
fixation.
Antibodies
Rabbit polyclonal antibodies used were anti-SEPT2, anti-SEPT6, anti-
SEPT9 (as described in [12]), anti-SEPT7 (IBL 18991), anti-p62 (MBL
PM045) or P-Drp1 (S616; Cell Signalling 3455S). Mouse monoclonal
antibodies used were anti-GAPDH (AbCam ab8245), anti-GFP
(ab1218), anti-GFP 3E1 monoclonal (Cancer Research UK), anti-p62
(BD 610832), Drp1 (ab56788) or Mfn1 (ab57602). Secondary anti-
bodies used were Alexa 488-, 555- or 647-conjugated donkey anti-
rabbit or donkey anti-mouse (Molecular Probes). F-actin was
labelled with Alexa 488, 555 or 647 phalloidin (Molecular Probes).
For immunoblotting, total cellular extracts eluted using Laemmli
buffer (10 mM Tris–Cl pH 6.8, 2% SDS, 10% glycerol, 5%
b-mercaptoethanol, 0.01% bromophenol blue) were blotted with
the above-mentioned antibodies followed by peroxidase-conjugated
goat anti-mouse (Dako) or anti-rabbit antibodies (Dako). GAPDH
was used throughout as a loading control. Proteins were run on 6,
8, 10 or 12% acrylamide gels. Protein levels were quantified by
using the densitometry tool in Fiji (http://fiji.sc/Fiji) [51].
Infections and microscopy
HeLa cells (1–2.5 × 105) were plated on glass coverslips in 6-well
plates (Thermo Scientific) and used for experiments 24–48 h later.
Cells on coverslips were fixed 15 min in 4% paraformaldehyde
(PFA) and washed with 1× PBS and processed for immunofluores-
cence. After 10 min of incubation in 0.05 M ammonium chloride,
cells were permeabilised 5–10 min with 0.1% Triton X-100 and then
incubated in 1× PBS. Incubation with primary or secondary antibod-
ies was performed in 1× PBS. Aqua polymount mounting medium
(Polyscience Inc.) for immunofluorescence was used.
Shigella was added to cells at an MOI of 100 (for quantification
analyses), or 400 ll of growth (OD600 nm = 0.6) was diluted in
DMEM and directly added to cells (for imaging analyses). Bacteria
and cells were centrifuged at 110 g for 10 min at 21°C and were
then placed at 37°C and 5% CO2 for 30 min, washed with DMEM
and incubated with fresh gentamicin-containing media (50 lg/ml)
for 1, 2, 4 or 5 h, after which they were washed with 1× PBS and
fixed and processed for immunofluorescence. x-light Shigella was
induced with 0.1 mM isopropyl b-D-1-thiogalactopyranoside (IPTG)
for 30 min prior to fixation.
Fixed samples images were acquired on fluorescence-inverted
microscope Axiovert 200 M (Carl Zeiss MicroImaging) driven by
Volocity software (ParkinElmer), Axiovert Z1 driven by ZEN soft-
ware Carl Zeiss MicroImaging) or confocal microscope LSM 710
(Carl Zeiss MicroImaging) driven by ZEN 2010 software. For live
microscopy, cells were grown on MatTek glass-bottom dishes
(MatTek corporation), then supplied with Opti-MEM (GIBCO)
medium and acquired using an LSM 710 and temperature-controlled
incubator (37°C).
For live/dead stain experiments, x-light Shigella was grown over-
night and subcultured to an OD600 nm = 0.6, then treated with 70%
isopropanol for 30 min prior to staining with SYTOX Orange. Live
images were acquired within 30–45 min in a temperature-controlled
incubator (37°C).
Quantitative microscopy (i.e. counting of septin cages) was
performed using a Z-stack image series, counting 300–800 bacteria
per experiment. Images were processed with Fiji (ImageJ) or Icy
(http://icy.bioimageanalysis.org) [52]. Where necessary, deconvo-
lution was performed using Huygens deconvolution software or
ZEN software. Mitochondrial length was measured as described in
[26,27]. In brief, Z-stack image series with 0.2-lm increments for
red channel (Mitotracker) were captured. The flat regions of cells
with clearly resolved mitochondria were selected, and 25–30
mitochondria per cell were measured using the line tool in Fiji or
Icy. For quantification of mitochondrial fission during infection,
only
mitochondria
surrounding Shigella were considered.
For
quantification of mitochondria length around septin cages, only
mitochondria associated with a majority of the septin cage was
considered.
Correlative light electron microscopy
For correlative light electron microscopy (CLEM), HeLa cells stably
expressing SEPT6-GFP were grown on cell-locator glass-bottom
dishes (MatTek Corporation), transfected with mito-BFP for 24 h,
infected with Shigella mCherry and processed for CLEM. To
preserve mitochondrial membrane, cells were pre-fixed for confocal
EMBO reports
Vol 17 | No 7 | 2016
ª 2016 The Authors
EMBO reports
Mitochondria promote septin cages
Andrea Sirianni et al
1040
Published online: June 3, 2016 

----!@#$NewPage!@#$----
microscopy with 4% PFA/0.25 M Hepes at 4°C for 10 min, then
with 8% PFA/0.25 M Hepes at room temperature. All the washing
steps were performed in 0.25 M Hepes buffer. Specific locations
were imaged and localised with high resolution on the cell-locator
glass-bottom dishes by using a confocal microscope LSM 710 (Carl
Zeiss MicroImaging) driven by ZEN 2010 software. For subsequent
transmission
electron
microscopy
(TEM)
analysis,
the
same
samples were fixed with 0.05% glutaraldehyde/0.2 M sodium
cacodylate for 45 min at room temperature. All the washing steps
were performed in 0.2 M sodium cacodylate buffer. Samples were
processed for TEM according to [12,53], the same coordinates
imaged with confocal microscopy were recovered, and then images
were acquired.
For SEPT7 labelling (Figs 4B and EV4), HeLa cells were fixed in
8% PFA/Hepes, and then cells were permeabilised with 0.2%
saponin. Cells were labelled using the SEPT7 antibody (1:1,000)
followed by horseradish peroxidase (HRP) anti-rabbit (1:1,000) and
then 5-min metal-enhanced DAB. Samples were then embedded into
Epon for EM.
Structured illumination microscopy (3D-SIM)
HeLa cells (1 × 105) were plated on high precision glass coverslips
(Carl Roth) in 6-well plates (Thermo Scientific) and used for experi-
ments 48 h later. Cells were infected with 400 ll of exponential
growing Shigella mCherry (OD600 nm = 0.6) for 4 h 40 min. Before
fixation for 15 min in 4% PFA, infected cells were pre-extracted for
30 s with 0.2% Triton X-100 in 1× BRB80 and were washed three
times in 1× PBS. After quenching for 10 min in 50 mM ammonium
chloride, cells were incubated with primary or secondary antibodies
in 1× PBS containing 0.1% Triton X-100 and 5% horse serum and
mounted in Vectashield for 3D-SIM. In brief, SIM generates high-
resolution images by applying grid patterns of light on a sample,
which are rotated and shifted at each focal plane. Fixed 3D-SIM
samples were imaged with Elyra S.1 (Carl Zeiss MicroImaging)
driven by ZEN 2012 software using five grid positions and three
rotations, resulting in 15 images of each focal plane. The recon-
structed, high-resolution 3D images were used to determine the
SEPT7 cage architecture.
Super-resolution optical fluctuation imaging
A super-resolution optical fluctuation imaging (SOFI)-based method
was used for imaging septins during mitochondrial fission in live
cells, as SOFI allows for the generation of super-resolution images
acquired at low-intensity laser illumination through the temporal
analysis of fluorescence intensity fluctuations [54]. For SOFI-based
super-resolution imaging, HeLa cells stably expressing SEPT6-GFP
were grown on glass-bottom dishes (MatTek Corporation) and
stained for 30 min with 20 nM MitoTracker Red CMXRos. Live cell
imaging of MitoTracker Red CMXRos and Sept6-GFP was performed
using an N-STORM inverted microscope (Nikon) in TIRF mode with
incubation at 37°C and 5% CO2; 561 nm and 488 nm excitation
lasers were angled through the back focal plane of a 60× objective
(Nikon) for imaging of MitoTracker Red CMXRos and GFP respec-
tively. A range of laser powers were tested for imaging the samples
to determine an appropriate power where sufficient fluctuations for
super resolution were achieved while maintaining cell viability. As
a result, time lapse imaging was performed using 1.24 W/cm2 for
MitoTracker Red CMXRos imaging and 0.82 W/cm2 for GFP imag-
ing. For each super-resolution image, 100 frames were acquired
with the 561 nm laser and 100 frames were acquired with the
488 nm laser; this was repeated every 30 s with both lasers turned
off between time points. Emitted signal from the excited MitoTracker
Red CMXRos and GFP molecules was collected by an EMCCD
camera (iXon Ultra 897, Andor) with an additional magnification
of 1.5×, yielding a pixel size of 178 nm. Final super-resolution
reconstructions were generated in Fiji through a custom-made SOFI-
based algorithm using second-order SOFI and generating images
with a pixel size of 36 nm.
SEPT6 immunoprecipitation and tandem affinity purification for
mass spectrometry
SEPT6 constructs for proteomic analysis of HeLa cells were used
because overexpression of SEPT6 does not inhibit Shigella invasion
(data not shown), and SEPT6 is strictly found with SEPT7 in septin
filaments and cages (Fig EV1A). To maximise the number of cells
infected with Shigella, we infected cells with S. flexneri M90T AfaI,
a hyper-invasive strain that expresses an adhesin from Escherichia
coli [47]. After establishing conditions in which ~80% of cells were
infected, and in these cells ~15% of bacteria recruit septin cages, we
performed pulldown experiments to isolate proteins associated with
the Shigella–septin cage. In parallel, control pulldown experiments
and mass spectrometry were also performed with cells that were
non-transfected and non-infected, non-transfected and infected, and
transfected and non-infected.
For tandem affinity purification, HeLa cells (5 × 106) were
plated in 15-cm plates. Plasmid transfections were performed the
following day using 5 lg of N-FLAG-2xSTREP-SEPT6-pcDNA3 and
10 ll jetPEI (Polyplus) per plate. For infection, Shigella AfaI was
added at MOI of 10 and bacteria and cells were placed at 37°C
and 10% CO2 for 30 min, washed with DMEM and incubated with
fresh gentamicin-containing media (50 lg/ml) for 4 h. 4–8 × 107
cells per condition were collected by centrifugation for 5 min at
1,000 g.
Cell pellets were lysed in 500 ll lysis buffer [10 mM Tris/Cl pH
7.5; 150 mM NaCl; 0.5 mM EDTA; 0.5% Triton X-100 1× cOmplete
(Roche)] and passed through a syringe (23G) 5×. Lysates were
centrifuged at 15,700 g for 20 min. Supernatants were applied to
ANTI-FLAG M2 Magnetic Beads (Sigma) and incubated for 2 h at
room temperature. Bound proteins were eluted using 3xFLAG
peptide (Sigma), and eluents were applied directed to STREP-Tactin
magnetic beads (IBA) and incubated for 2 h at room temperature.
Bound proteins were eluted with 0.1 M glycine HCl, pH 3.0. Final
elutions were run on an SDS–PAGE gel, and total protein in gel was
sent for mass spectrometry service (http://mslab-ibb.pl/). The
resulting MS/MS data were used as input for protein identification
by
MASCOT
(www.matrixscience.com)
search
using
the
UniprotKB/Swiss-Prot database. Each condition was performed in
duplicate, and hits were pooled for annotation. The “CRAPome”
(www.crapome.org)
database
was
used
to
manually
remove
commonly occurring results, and Gene Ontology (http://geneontol-
ogy.org/) was used to putatively annotate protein function.
For immunoprecipitation of SEPT6-GFP (Fig 2B), 1 × 107 cells
were plated in 15-cm plates. For infection, Shigella AfaI was added
ª 2016 The Authors
EMBO reports
Vol 17 | No 7 | 2016
Andrea Sirianni et al
Mitochondria promote septin cages
EMBO reports
1041
Published online: June 3, 2016 

----!@#$NewPage!@#$----
at MOI of 10 and bacteria and cells were placed at 37°C and 10%
CO2 for 30 min, washed with DMEM and incubated with fresh
gentamicin-containing
media
(50 lg/ml)
for
4 h.
Two
plates
(4 × 107 cells) per condition were collected by centrifugation for
5 min at 1,000 g. Cell pellets were lysed in 200 ll lysis buffer
[10 mM Tris/Cl pH 7.5; 150 mM NaCl; 0.5 mM EDTA; 0.5% NP-40,
1× cOmplete (Roche)]. Lysates were centrifuged at 15,700 g for
20 min. Supernatants were applied to GFP-Trap agarose (Chro-
motek) and incubated for 1 h at room temperature. Bound proteins
were eluted using Laemmli buffer (10 mM Tris–Cl pH 6.8, 2% SDS,
10% glycerol, 5% b-mercaptoethanol, 0.01% bromophenol blue).
For Fig 5C, HeLa cells stably expressing either GFP or GFP-SEPT6
were grown to 80% confluency in 15-cm dishes. After washing once
with ice-cold PMSF (1 mM), cells were scraped into 600 ll lysis
buffer and incubated at 4°C for 10 min. Cell lysates were clarified at
15,700 g at 4°C for 5 min, and the supernatant retained. Lysates
were diluted with the addition of 400 ll of wash buffer. Thirty
microlitres of the diluted lysate was retained as an input sample, to
which 30 ll of 2× Laemmli buffer was added. Sixty microlitres of
pre-washed GFP-Trap beads (Chromotek) was added to cell lysates
and the mixture was rotated for 1 h at 4°C. GFP-Trap beads were
then washed 3× with ice-cold wash buffer and finally resuspended
in 60 ll of Laemmli buffer. GFP-Trap beads and input samples were
boiled at 95°C for 10 min, and samples were resolved by SDS–
PAGE.
Statistics
Statistical analysis was performed in Excel (Microsoft) or Prism
GraphPad. Pearson’s correlation coefficient was calculated using Icy
colocalisation studio plugin (http://icy.bioimageanalysis.org). Cells
dying from bacterial infection were not considered for analysis.
Unless otherwise indicated, data are presented as mean � standard
error of the mean (SEM) from at least three independent experi-
ments per treatment. Unless otherwise indicated, Student’s t-test
(paired, two-tailed) was used to compare values, with P < 0.05
considered as significant.
Expanded View for this article is available online.
Acknowledgements
We thank J. Enninga, P. Sansonetti, F.X. Campbell, L. Baxt and I. Rosenshine for
Shigella tools. We thank M. Campanella, D. Faccenda and D.W. Hailey for mito-
chondria tools. We thank D. Judith, S. Tooze and M. Dionne for autophagy tools
and discussion. RH and SC work is funded by the Medical Research Council
(MR/K015826/1) and Biotechnology and Biological Sciences Research Council
(BB/M022374/1). Work in the SM laboratory is supported by a Wellcome Trust
Research Career Development Fellowship (WT097411MA) and the Lister Insti-
tute of Preventive Medicine.
Author contributions
AS, SK, DL-M, SB, JP, DG, AW, SC, RH, GL-M, MH, VS-S and SM performed
experiments and analysed data. SM conceived/designed experiments. MW
and SM wrote the manuscript, and all authors commented on the
manuscript.
Conflict of interest
The authors declare that they have no conflict of interest.
References
1.
Feng Y, He D, Yao Z, Klionsky DJ (2014) The machinery of macro-
autophagy. Cell Res 24: 24 – 41
2.
Levine B, Mizushima N, Virgin HW (2011) Autophagy in immunity and
inflammation. Nature 469: 323 – 335
3.
Shibutani ST, Saitoh T, Nowag H, Munz C, Yoshimori T (2015) Autophagy
and autophagy-related proteins in the immune system. Nat Immunol 16:
1014 – 1024
4.
Randow F, Youle Richard J (2014) Self and nonself: how autophagy
targets mitochondria and bacteria. Cell Host Microbe 15: 403 – 411
5.
Stolz A, Ernst A, Dikic I (2014) Cargo recognition and trafficking in selec-
tive autophagy. Nat Cell Biol 16: 495 – 501
6.
Mostowy S (2014) Multiple roles of the cytoskeleton in bacterial autop-
hagy. PLoS Pathog 10: e1004409
7.
Monastyrska I, Rieter E, Klionsky DJ, Reggiori F (2009) Multiple roles of
the cytoskeleton in autophagy. Biol Rev 84: 431 – 448
8.
Yoshikawa Y, Ogawa M, Hain T, Yoshida M, Fukumatsu M, Kim M,
Mimuro H, Nakagawa I, Yanagawa T, Ishii T, et al (2009) Listeria mono-
cytogenes ActA-mediated escape from autophagic recognition. Nat Cell
Biol 11: 1233 – 1240
9.
Ogawa M, Yoshimori T, Suzuki T, Sagara H, Mizushima N, Sasakawa C
(2005) Escape of intracellular Shigella from autophagy. Science 307:
727 – 731
10.
Mostowy S, Cossart P (2012) Septins: the fourth component of the
cytoskeleton. Nat Rev Mol Cell Biol 13: 183 – 194
11.
Saarikangas J, Barral Y (2011) The emerging functions of septins in
metazoans. EMBO Rep 12: 1118 – 1126
12.
Mostowy S, Bonazzi M, Hamon MA, Tham TN, Mallet A, Lelek M, Gouin
E, Demangel C, Brosch R, Zimmer C, et al (2010) Entrapment of intracy-
tosolic bacteria by septin cage-like structures. Cell Host Microbe 8:
433 – 444
13.
Mostowy S, Sancho-Shimizu V, Hamon MA, Simeone R, Brosch R,
Johansen T, Cossart P (2011) p62 and NDP52 proteins target intracytoso-
lic Shigella and Listeria to different autophagy pathways. J Biol Chem
286: 26987 – 26995
14.
Mostowy S, Boucontet L, Mazon Moya MJ, Sirianni A, Boudinot P,
Hollinshead M, Cossart P, Herbomel P, Levraud J-P, Colucci-Guyon E
(2013) The zebrafish as a new model for the in vivo study of Shigella
flexneri interaction with phagocytes and bacterial autophagy. PLoS
Pathog 9: e1003588
15.
Sirajuddin M, Farkasovsky M, Hauer F, Kuhlmann D, Macara IG, Weyand
M, Stark H, Wittinghofer A (2007) Structural insight into filament forma-
tion by mammalian septins. Nature 449: 311 – 315
16.
John CM, Hite RK, Weirich CS, Fitzgerald DJ, Jawhari H, Faty M, Schläpfer
D, Kroschewski R, Winkler FK, Walz T, et al (2007) The Caenorhabditis
elegans septin complex is nonpolar. EMBO J 26: 3296 – 3307
17.
Bertin A, McMurray MA, Grob P, Park S-S, Garcia G, Patanwala I, Ng H-l,
Alber T, Thorner J, Nogales E (2008) Saccharomyces cerevisiae septins:
supramolecular organization of heterooligomers and the mechanism of
filament assembly. Proc Natl Acad Sci USA 105: 8274 – 8279
18.
Kinoshita M, Field CM, Coughlin ML, Straight AF, Mitchison TJ (2002)
Self- and actin-templated assembly of mammalian septins. Dev Cell 3:
791 – 802
19.
Rambold AS, Kostelecky B, Elia N, Lippincott-Schwartz J (2011) Tubular
network formation protects mitochondria from autophagosomal degra-
dation during nutrient starvation. Proc Natl Acad Sci USA 108:
10190 – 10195
EMBO reports
Vol 17 | No 7 | 2016
ª 2016 The Authors
EMBO reports
Mitochondria promote septin cages
Andrea Sirianni et al
1042
Published online: June 3, 2016 

----!@#$NewPage!@#$----
20.
Gomes LC, Benedetto GD, Scorrano L (2011) During autophagy mito-
chondria elongate, are spared from degradation and sustain cell viabil-
ity. Nat Cell Biol 13: 589 – 598
21.
Praefcke GJK, McMahon HT (2004) The dynamin superfamily: universal
membrane tubulation and fission molecules? Nat Rev Mol Cell Biol 5:
133 – 147
22.
Schrepfer E, Scorrano L (2016) Mitofusins, from mitochondria to meta-
bolism. Mol Cell 61: 683 – 694
23.
Hatch AL, Gurel PS, Higgs HN (2014) Novel roles for actin in mitochon-
drial fission. J Cell Sci 127: 4549 – 4560
24.
Li S, Xu S, Roelofs BA, Boyman L, Lederer WJ, Sesaki H, Karbowski M
(2015) Transient assembly of F-actin on the outer mitochondrial
membrane contributes to mitochondrial fission. J Cell Biol 208: 109 – 123
25.
Manor U, Bartholomew S, Golani G, Christenson E, Kozlov M, Higgs H,
Spudich J, Lippincott-Schwartz J (2015) A mitochondria-anchored
isoform of the actin-nucleating Spire protein regulates mitochondrial
division. eLife 4: e08828
26.
Korobova F, Ramabhadran V, Higgs HN (2013) An actin-dependent step
in mitochondrial fission mediated by the ER-associated formin INF2.
Science 339: 464 – 467
27.
Korobova F, Gauvin Timothy J, Higgs Henry N (2014) A role for myosin II
in mammalian mitochondrial fission. Curr Biol 24: 409 – 414
28.
De Vos KJ, Allan VJ, Grierson AJ, Sheetz MP (2005) Mitochondrial function
and actin regulate dynamin-related protein 1-dependent mitochondrial
fission. Curr Biol 15: 678 – 683
29.
Glotzer M (2005) The molecular requirements for cytokinesis. Science
307: 1735 – 1739
30.
Kissel H, Georgescu M-M, Larisch S, Manova K, Hunnicutt GR, Steller H
(2005) The Sept4 septin locus is required for sperm terminal differentia-
tion in mice. Dev Cell 8: 353 – 364
31.
Pistor S, Chakraborty T, Niebuhr K, Domann E, Wehland J (1994) The
ActA protein of Listeria monocytogenes acts as a nucleator inducing reor-
ganization of the actin cytoskeleton. EMBO J 13: 758 – 763
32.
Chang C-R, Blackstone C (2010) Dynamic regulation of mitochondrial
fission through modification of the dynamin-related protein Drp1. Ann N
Y Acad Sci 1201: 34 – 39
33.
Taguchi N, Ishihara N, Jofuku A, Oka T, Mihara K (2007) Mitotic phos-
phorylation of dynamin-related GTPase Drp1 participates in mitochon-
drial fission. J Biol Chem 282: 11521 – 11529
34.
Carneiro LAM, Travassos LH, Soares F, Tattoli I, Magalhaes JG, Bozza MT,
Plotkowski MC, Sansonetti PJ, Molkentin JD, Philpott DJ, et al (2009)
Shigella induces mitochondrial dysfunction and cell death in nonmy-
leoid cells. Cell Host Microbe 5: 123 – 136
35.
Tattoli I, Sorbara MT, Vuckovic D, Ling A, Soares F, Carneiro Leticia AM,
Yang C, Emili A, Philpott Dana J, Girardin Stephen E (2012) Amino acid
starvation induced by invasive bacterial pathogens triggers an innate
host defense program. Cell Host Microbe 11: 563 – 575
36.
Lum M, Morona R (2014) Dynamin-related protein Drp1 and mitochon-
dria are important for Shigella flexneri infection. Int J Med Microbiol 304:
530 – 541
37.
Stavru F, Bouillaud F, Sartori A, Ricquier D, Cossart P (2011) Listeria
monocytogenes transiently alters mitochondrial dynamics during infec-
tion. Proc Natl Acad Sci USA 108: 3612 – 3617
38.
Welch MD, Way M (2013) Arp2/3-mediated actin-based motility: a tail of
pathogen abuse. Cell Host Microbe 14: 242 – 255
39.
Friedman JR, Nunnari J (2014) Mitochondrial form and function. Nature
505: 335 – 343
40.
Friedman JR, Lackner LL, West M, DiBenedetto JR, Nunnari J, Voeltz GK
(2011) ER tubules mark sites of mitochondrial division. Science 334:
358 – 362
41.
Phillips MJ, Voeltz GK (2016) Structure and function of ER
membrane contact sites with other organelles. Nat Rev Mol Cell Biol
17: 69 – 82
42.
Hailey DW, Rambold AS, Satpute-Krishnan P, Mitra K, Sougrat R,
Kim PK, Lippincott-Schwartz J (2010) Mitochondria supply
membranes for autophagosome biogenesis during starvation. Cell 141:
656 – 667
43.
Bridges AA, Jentzsch MS, Oakes PW, Occhipinti P, Gladfelter AS (2016)
Micron-scale plasma membrane curvature is recognized by the septin
cytoskeleton. J Cell Biol 213: 23 – 32
44.
Bezanilla M, Gladfelter AS, Kovar DR, Lee W-L (2015) Cytoskeletal
dynamics: a view from the membrane. J Cell Biol 209: 329 – 337
45.
Tanaka-Takiguchi Y, Kinoshita M, Takiguchi K (2009) Septin-mediated
uniform bracing of phospholipid membranes. Curr Biol 19: 140 – 145
46.
Mostowy S, Shenoy AR (2015) The cytoskeleton in cell-autonomous
immunity: structural determinants of host defence. Nat Rev Immunol 15:
559 – 573
47.
Mazon Moya MJ, Colucci-Guyon E, Mostowy S (2014) Use of Shigella
flexneri to study autophagy-cytoskeleton interactions. J Vis Exp 91:
e51601
48.
Schlosser-Silverman E, Elgrably-Weiss M, Rosenshine I, Kohen R, Altuvia
S (2000) Characterization of Escherichia coli DNA lesions generated
within J774 macrophages. J Bacteriol 182: 5225 – 5230
49.
Barry DJ, Durkin CH, Abella JV, Way M (2015) Open source software for
quantification of cell migration, protrusions, and fluorescence intensi-
ties. J Cell Biol 209: 163 – 180
50.
Santos J, Cerveira N, Bizarro S, Ribeiro FR, Correia C, Torres L, Lisboa S,
Vieira J, Mariz JM, Norton L, et al (2010) Expression pattern of the septin
gene family in acute myeloid leukemias with and without MLL-SEPT
fusion genes. Leuk Res 34: 615 – 621
51.
Schindelin J, Arganda-Carreras I, Frise E, Kaynig V, Longair M, Pietzsch
T, Preibisch S, Rueden C, Saalfeld S, Schmid B, et al (2012) Fiji: an
open-source platform for biological-image analysis. Nat Methods 9:
676 – 682
52.
de Chaumont F, Dallongeville S, Chenouard N, Herve N, Pop S, Provoost
T, Meas-Yedid V, Pankajakshan P, Lecomte T, Le Montagner Y, et al
(2012) Icy: an open bioimage informatics platform for extended reprodu-
cible research. Nat Meth 9: 690 – 696
53.
Hollinshead M, Johns HL, Sayers CL, Gonzalez-Lopez C, Smith GL, Elliott
G (2012) Endocytic tubules regulated by Rab GTPases 5 and 11 are used
for envelopment of herpes simplex virus. EMBO J 31: 4204 – 4220
54.
Dertinger T, Colyer R, Iyer G, Weiss S, Enderlein J (2009) Fast, back-
ground-free, 3D super-resolution optical fluctuation imaging (SOFI). Proc
Natl Acad Sci USA 106: 22287 – 22292
License: This is an open access article under the
terms of the Creative Commons Attribution 4.0
License, which permits use, distribution and reproduc-
tion in any medium, provided the original work is
properly cited.
ª 2016 The Authors
EMBO reports
Vol 17 | No 7 | 2016
Andrea Sirianni et al
Mitochondria promote septin cages
EMBO reports
1043
Published online: June 3, 2016